Back to search resultsSummaryRMgm-763
|
||||||||
*RMgm-763| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene tagging |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 23490234 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255) |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | J. Lin; S.M. Khan; C.J. Janse |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center (LUMC) |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-763 |
| Principal name | 654cl1 |
| Alternative name | rom3::gfp |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | GFP-ROM3 expression was observed in female gametocytes. |
| Fertilization and ookinete | GFP-ROM3 expression was observed in female gametocytes and ookinetes. |
| Oocyst | No GFP signals were observed in developing oocysts or in sporozoites |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation In the rom3::gfp mutant GFP-ROM3 expression was observed in female gametocytes and ookinetes. GFP-signals were not detected in developing oocysts. |
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0702700 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0828000 | ||||||||||||||||||||||||||
| Gene product | rhomboid protease ROM3 | ||||||||||||||||||||||||||
| Gene product: Alternative name | ROM3 | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | GFP | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | |||||||||||||||||||||||||||
| Type of plasmid/construct | Plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() ATCTGCAGAATTCGCCCTTAAAATCGATGAATTCCAACAATGAATGTAATAAAGGTAATG
| ||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||