Summary

RMgm-659
Malaria parasiteP. yoelii
Genotype
DisruptedGene model (rodent): PY17X_0935500; Gene model (P.falciparum): PF3D7_1114100; Gene product: rhomboid protease ROM1 (ROM1)
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0719300; Gene model (P.falciparum): PF3D7_0417200; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (DHFR-TS)
Replacement locus: Gene model: PY00729; Gene product: Rhomboid family, putative (ROM1)
Phenotype Asexual bloodstage; Liver stage;
Last modified: 11 October 2011, 14:40
  *RMgm-659
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21909259
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line17XNL is a non-lethal strain of P. yoelii
The mutant parasite was generated by
Name PI/ResearcherI. Medina Vera; K. Kim
Name Group/DepartmentDepartments of Medicine and of Microbiology and Immunology
Name InstituteAlbert Einstein College of Medicine
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-659
Principal nameRIKO-1; RIKO-2
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageAnalysis of course of blood stage infection in BALB/c mice indicates a mild attenuation of mutant parasites with a decrease in peak parasitemia (25% versus 43%) and a decrease in the duration of infection compared to the wildtype control
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot tested
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageSporozoites showed normal motility and traversal and invasion of hepatocytes. However, during development of the liver stages, the number of infected hepatocytes significantly decreased during the first 24 hours compared to wild type liver stages.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of rhomboid protease ROM1.

Protein (function)
Rhomboid proteins are intra-membrane proteases that play a role in multiple processes. They belong to a family of serine proteases that cleave cell-surface proteins within their transmembrane domains. The Plasmodium genome encodes a total of 8 rhomboid proteases (ROM1, 3, 4, 6, 7, 10; Dowse, TJ and Soldati, D, 2005, Trends Parasitol 21, 254-58) that show stage-specific expression patterns and includes proteins upregulated in gametocytes and sporozoites. ROM1 is expressed in both the blood stages and mosquito stages (sporozoites). ROM1 was localized to organelles of the apical complex of merozoites and was shown to be able to cleave different adhesins of all invasive stages (merozoites, ookinetes, sporozoites).

Phenotype
Phenotype analyses indicate indicates a mild attenuation of of blood stages of mutant parasites. Evidence is presented that lack of ROM1 expression does not affect development of oocysts, sporozoite release into the hemolymph,  invasion of salivary glands and sporozoite motility and invasion of hepatocytes.
During development of the mutant liver stages, the number of infected hepatocytes significantly decreased during the first 24 hours compared to wild type liver stages and evidence is presented that mutant liver stages are affected in the formation of a parasitophorous vacuole membrane (see also 'Additional information').

Additional information
The sequence of P. yoelii rhomboid 1 (pyrom1) obtained consists of 4 exons and 3 introns, encompassing two annotated genes py00729 and py00728. Based on topology predictions (TMHMM and HMMTOP), PyROM1 has seven transmembrane domains with the canonical rhomboid catalytic serine motif (GASTS) found within transmembrane domain four and a conserved histidine found within transmembrane domain six. It has an N-terminal tail of 52 amino acids that includes the conserved microneme targeting motif YPHY and a very short carboxy terminal tail.

Amplification of Pyrom1 cDNA from synchronized erythrocytic stages shows modest expression, with greatest expression in schizont (S) stages. There is a 10-fold increased expression in midgut (MG) sporozoites and a 20-fold increased expression in salivary gland (SG) sporozoites relative to expression levels of schizont stages.

Evidence is presented that the percentage of developing liver stages surrounded by a UIS4-positive parasitophorous vacuole membrane (PVM) was significantly reduced in mutant parasites compared to wild type liver stages. Mutant parasites had a 33% and 43% decrease compared to wild type parasites of UIS4 positive staining at 2 hours and 6 hours, respectively. Evidence is presented that UIS4 can serve as a substrate to rhomboid proteases. UIS4 belongs to the eTRAMP protein family that contain a conserved transmembrane domain with sequence similarity to known rhomboid substrates.
Electron microscope analyses indicate that while mutant sporozoites are capable of productively invading host cells with the formation of a PVM, a fraction of them have a defect in the subsequent PV expansion and modification in early development.

Analysis of a mutant expressing a (N-terminal) HA-tagged version of PyROM1 (RMgm-660) confirmed expression of the protein in blood stage schizonts and in salivary gland sporozoites. Immunofluorescence analyses showed co-localisation with micronemal (MAEBL), rhoptry (RON4) and endoplasmic reticulum (BiP) markers.

A mutant lacking expression of ROM1 has also been generated in P. berghei (RMgm-176). Phenotype analyses of this mutant indicated that ROM1 plays distinct roles during P. berghei development. It is non-essential but appears to play a role in blood stages, the transformation of ookinetes into oocysts and in the establishment of infection of the liver by the sporozoite. P. berghei  ROM1 is not required for sporozoite invasion of the salivary glands.

Initially, a single crossover homologous recombination strategy was used to disrupt the endogenous pyrom1 locus. Successful disruption of the pyrom1 gene was confirmed by Southern blot and RT-PCR (not entered into the RMgm database). Because single crossover disruptants can revert to wildtype, another deletion mutant was created using a gene replacement vector to exchange the endogenous pyrom1 gene for a pbDHFR/TS-GFP cassette by double crossover homologous recombination (described here).


Other mutants
RMgm-176:  A P. berghei mutant lacking expression of ROM1.
RMgm-187: Unsuccessful attempts to disrupt rhomboid protease ROM4 of P. berghei.
RMgm-660: A mutant expressing a (N-terminal) HA-tagged version of PyROM1


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PY17X_0935500
Gene Model P. falciparum ortholog PF3D7_1114100
Gene productrhomboid protease ROM1
Gene product: Alternative nameROM1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, NotI, ScaI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption The integration of the construct deletes exons 1–3 of the pyrom1 gene that include the region encoding the functional catalytic serine motif and the conserved histidine.
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationP. yoelii 17XNL genomic DNA was used to amplify two 600 base pair (bp) fragments that are upstream and downstream of the pyrom1 coding region using primers pyR1.5'KpnI-F, pyR1.5'XhoI-R, pyR1.3'BamHI-F, pyR1.3'NotI-R, containing appropriate restriction sites to facilitate cloning of the PCR fragments into the PMD205GFP vector. This vector contains a selection cassette that expresses the P. berghei dihydrofolate reductase-thymidylate synthase (pbDHFR-TS) gene fused to the Green Fluorescent Protein (GFP) open reading frame under the control of the pbDHFR promoter. The resulting targeting construct contains the pbDHFR-TS/GFP selection cassette flanked by the upstream (59ARM) and downstream (39ARM) fragments from the pyrom1 genetic locus. The targeting vector was linearized using restriction enzymes KpnI, NotI, and ScaI prior to transfection.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGTACCTTAATTAAGCAAGCTTCCGAA
Additional information primer 1pyR1.5'KpnI F
Sequence Primer 2CTCGAGACAATGAAAAAGGAAGAAACACTC
Additional information primer 2pyR1.5XhoI R
Sequence Primer 3GGATCCAGATGGAAAACAAACCAACAT
Additional information primer 3pyR1.3'BamHI F
Sequence Primer 4GCGGCCGCTGACGCTTAGTGTTTAAATATTGTT
Additional information primer 4pyR1.3'NotI R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, NotI, ScaI
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationP. yoelii 17XNL genomic DNA was used to amplify two 600 base pair (bp) fragments that are upstream and downstream of the pyrom1 coding region using primers pyR1.5'KpnI-F, pyR1.5'XhoI-R, pyR1.3'BamHI-F, pyR1.3'NotI-R, containing appropriate restriction sites to facilitate cloning of the PCR fragments into the PMD205GFP vector. This vector contains a selection cassette that expresses the P. berghei dihydrofolate reductase-thymidylate synthase (pbDHFR-TS) gene fused to the Green Fluorescent Protein (GFP) open reading frame under the control of the pbDHFR promoter. The resulting targeting construct contains the pbDHFR-TS/GFP selection cassette flanked by the upstream (59ARM) and downstream (39ARM) fragments from the pyrom1 genetic locus. The targeting vector was linearized using restriction enzymes KpnI, NotI, and ScaI prior to transfection.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0719300
Gene Model P. falciparum ortholog PF3D7_0417200
Gene productbifunctional dihydrofolate reductase-thymidylate synthase
Gene product: Alternative nameDHFR-TS
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative nameDHFR-TS
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PY00729
Gene productRhomboid family, putative
Gene product: Alternative nameROM1
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATGAGTAAAGGAGAAGAACTTTTCACT
Additional information primer 1GFP F
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4