SummaryRMgm-759
|
Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
The following genetic modifications were attempted | Gene disruption |
Number of attempts to introduce the genetic modification | 3 |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 23490234 |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | Two attempts to disrupt rom7 were made in P. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32). This is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192). A third attempt to disrupt rom7 was made in P. berghei ANKA 676m1cl1 (RMgm-29). This is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
top of page | |
Attempts to generate the mutant parasite were performed by | |
Name PI/Researcher | J. Lin, G.R. Mair, C.J. Janse, S.M. Khan |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center (LUMC) |
City | Leiden |
Country | The Netherlands |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1134600 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1358300 | ||||||||||||||||||||||||
Gene product | rhomboid protease ROM7 | ||||||||||||||||||||||||
Gene product: Alternative name | ROM7 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | PCR construct | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map |
![]() | ||||||||||||||||||||||||
Plasmid/construct sequence |
![]() ![]() GAACTCGTACTCCTTGGTGACGTCGCGATGCTTTGTATTTTCATTGGAGATATAGTATTT
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | NruI | ||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | 5-fluorocytosine (5-FC) | ||||||||||||||||||||||||
Additional remarks genetic modification | The unsuccessful attempts to disrupt the rom7 gene suggest that ROM7 is essential for asexual blood stage development (exp. 2120, 2121, 2141). Rhomboid proteins are intra-membrane proteases that play a role in multiple processes. They belong to a family of serine proteases that cleave cell-surface proteins within their transmembrane domains. The Plasmodium genome encodes a total of 8 rhomboid proteases (ROM1, 3, 4, 6, 7, 8, 9 and 10). Attempts to disrupt the gene were made using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below). The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4 respectively. Primers 2 and 3 have 5’- extensions homologues to the hdhfr::yfcu selectable marker cassette (CATCTACAAGCATCGTCGACCTC in primer 2 and CCTTCAATTTCGGATCCACTAG in primer 3). This selectable marker cassette was excised by digestion with XhoI and NotI from a plasmid (pL0048) that contains the P. berghei eef1a-hdfhr::yfcu-3’dhfr/ts (i.e. promoter-drug selectable marker-3’ terminator sequence) selection cassette. Primers 1 and 4 have 5’-terminal extensions with an anchor-tag suitable for the second PCR reaction. In the second PCR reaction, the amplified 5’- and 3’- targeting sequences were annealed to either side of the selectable marker cassette, and the joint fragment was amplified by the external anchor-tag primers 5/6, resulting in the PCR-based targeting construct Before transfection, the PCR-based construct was digested with NruI (in primers 1 and 4) to remove the ‘anchor-tag’ and with DpnI that digests any residual pL0048 plasmid. | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
![]()
| |||||||||||||||||||||||||
top of page |