Summary

RMgm-176
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0933500; Gene model (P.falciparum): PF3D7_1114100; Gene product: rhomboid protease ROM1 (ROM1)
Phenotype Asexual bloodstage; Fertilization and ookinete; Oocyst; Sporozoite; Liver stage;
Last modified: 10 October 2011, 09:01
  *RMgm-176
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19148267
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherP. Srinivasan; M. Jacobs-Lorena
Name Group/DepartmentDepartment of Molecular Microbiology and Immunology
Name InstituteMalaria Research Institute, John Hopkins School of Public Health
CityBaltimore, Maryland
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-176
Principal namerom1(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageParasitemia develops slower in mice infected with the mutant parasites. Peak parasitemias in mice are comparable to those in wild type infected mice. More then 80% of mice infected with mutant parasites survive infection and clear the parasites from the blood.
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of ookinetes are produced. A strong reduction in oocyst production.
OocystA strong reduction in oocyst production (mean number of oocysts in wild type ranging from 79-213 and in mutants 3-124). Subsequent development of mutant oocysts appears to be normal. The number of mutant sporozoites in oocysts was similar to wild-type oocysts.
SporozoiteA strong reduction in oocyst production (mean number of oocysts in wild type ranging from 79-213 and in mutants 3-124). Subsequent development of mutant oocysts appears to be normal. The number of mutant sporozoites in oocysts was similar to wild-type oocysts. No differences of salivary gland invasion of the mutant sporozoites could be detected. Salivary gland sporozoites showed normal gliding motility. The efficiency of liver infection in vivo of the mutant sporozoites was lower (68%) compared to wild type sporozoites.
Liver stageThe efficiency of liver infection in vivo of the mutant sporozoites was lower (68%) compared to wild type sporozoites.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of rhomboid protease ROM1.

Protein (function)
Rhomboid proteins are intra-membrane proteases that play a role in multiple processes. They belong to a family of serine proteases that cleave cell-surface proteins within their transmembrane domains. The Plasmodium genome encodes a total of 8 rhomboid proteases (ROM1, 3, 4, 6, 7, 10; Dowse, TJ and Soldati, D, 2005, Trends Parasitol 21, 254-58)  that show stage-specific expression patterns and includes proteins upregulated in gametocytes and sporozoites. ROM1 is expressed in both the blood stages and mosquito stages (sporozoites). ROM1 was localized to organelles of the apical complex of merozoites and was shown to be able to cleave different adhesins of all invasive stages (merozoites, ookinetes, sporozoites).

Phenotype
The phenotype analyses indicate that ROM1 plays distinct roles during parasite development. It is non-essential but appears to play a role in blood stages, the transformation of ookinetes into oocysts and in the establishment of infection of the liver by the sporozoite.  ROM1 is not required for sporozoite invasion of the salivary glands.

Additional information
The ROM1 gene has been disrupted into the genome by single cross-over integration. Therefore the possibility exists of reversion to the wild-type genotype by removal of the integrated DNA construct. The phenotype analyses are performed with only a single mutant parasite line.
Evidence is presented that TRAP (PF13_0201;  PB000374.03.0 ; Thrombospondin-related anonymous protein) is not a substrate for ROM1.
Mice that cleared infections with the mutant parasites developed protective immune responses and were protected against challenge with wild type parasites.

Other mutants
RMgm-659: P. yoelii mutant lacking expression of ROM1
RMgm-660: P. yoelii mutant expressing an N-terminally triple HA-tagged ROM1

See RMgm-187 for unsuccessful attempts to disrupt rhomboid protease ROM4 in P. berhei.


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0933500
Gene Model P. falciparum ortholog PF3D7_1114100
Gene productrhomboid protease ROM1
Gene product: Alternative nameROM1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid NdeI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe ROM1 gene has been disrupted into the genome by single cross-over integration. Therefore the possibility exists of reversion to the wild-type genotype by removal of the integrated DNA construct.
Upon a single crossover event, the region of homology is duplicated, resulting in two truncated, non expressed rom1 gene copies in the integrated locus.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCATACATTAGCAGAGTATAGGGA
Additional information primer 1PbROM1(−)F
Sequence Primer 2ACTTGCACCCACTTTTATTGTAC3
Additional information primer 2PbROM1(−)R
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6