SummaryRMgm-758
|
||||||||||
*RMgm-758| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 3 |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 23490234 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | Not applicable |
| Other information parent line | Two attempts to disrupt rom6 were made in P. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32). This is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192). A third attempt to disrupt rom6 was made in P. berghei ANKA 676m1cl1 (RMgm-29). This is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | J. Lin, G.R. Mair, C.J. Janse, S.M. Khan |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center (LUMC) |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1358100 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1345200 | ||||||||||||||||||||||||
| Gene product | rhomboid protease ROM6, putative | ||||||||||||||||||||||||
| Gene product: Alternative name | ROM6 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | PCR construct | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() GAACTCGTACTCCTTGGTGACGTCGCGACTATTTTTTATAGGCACATTTTGTGTGATATC
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | NruI | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | 5-fluorocytosine (5-FC) | ||||||||||||||||||||||||
| Additional remarks genetic modification | The unsuccessful attempts to disrupt the rom6 gene suggest that ROM6 is essential for asexual blood stage development (exp. 2118, 2119, 2140). Rhomboid proteins are intra-membrane proteases that play a role in multiple processes. They belong to a family of serine proteases that cleave cell-surface proteins within their transmembrane domains. The Plasmodium genome encodes a total of 8 rhomboid proteases (ROM1, 3, 4, 6, 7, 8, 9 and 10). Plasmodium ROM6 is the ortholog of T. gondii ROM6, which clusters with the PARL-like mitochondrial rhomboids and localizes to the single mitochondrion. These ROM6 proteins share common features in their TM domains and catalytic sites, which are characteristic for PARL-type rhomboids and contain predicted mitochondrial-targeting sequences. Attempts to disrupt the gene were made using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below). The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4 respectively. Primers 2 and 3 have 5’- extensions homologues to the hdhfr::yfcu selectable marker cassette (CATCTACAAGCATCGTCGACCTC in primer 2 and CCTTCAATTTCGGATCCACTAG in primer 3). This selectable marker cassette was excised by digestion with XhoI and NotI from a plasmid (pL0048) that contains the P. berghei eef1a-hdfhr::yfcu-3’dhfr/ts (i.e. promoter-drug selectable marker-3’ terminator sequence) selection cassette. Primers 1 and 4 have 5’-terminal extensions with an anchor-tag suitable for the second PCR reaction. In the second PCR reaction, the amplified 5’- and 3’- targeting sequences were annealed to either side of the selectable marker cassette, and the joint fragment was amplified by the external anchor-tag primers 5/6, resulting in the PCR-based targeting construct Before transfection, the PCR-based construct was digested with NruI (in primers 1 and 4) to remove the ‘anchor-tag’ and with DpnI that digests any residual pL0048 plasmid. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||