Summary

RMgm-310
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0408200; Gene model (P.falciparum): PF3D7_0310100; Gene product: calcium-dependent protein kinase 3 (CDPK3)
DisruptedGene model (rodent): PBANKA_1333700; Gene model (P.falciparum): PF3D7_1470500; Gene product: phosphodiesterase delta, putative (PDEδ, Phosphodiesterase delta)
Phenotype Fertilization and ookinete;
Last modified: 21 December 2011, 14:42
  *RMgm-310
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19779564
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherR.W. Moon; D.A. Baker; O. Billker
Name Group/DepartmentDepartment of Cell and Molecular Biology
Name InstituteImperial College London
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-310
Principal namecdpk3 pdeδ double KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal fertilisation rates and ookinete production. Mature ookinetes showed an aberrant morphology as described for mutant ookinetes lacking expression of PDEδ (RMgm-308). The gliding motility of immature ookinetes (12-15h) was not affected as has been found in ookinetes lacking expression of only CDPK3 (RMgm-154)
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of CDPK3 (calcium-dependent protein kinase 3) and cyclic nucleotide phosphodiesterase, putative (PDEδ, phosphodiesterase delta; cyclic nucleotide phosphodiesterase, putative). The cdpk3 pdeδ double KO mutant was produced by crossing (in the mosquitoe) the cdpk3 KO mutant  (RMgm-154) with the pdeδ KO mutant (RMgm-308).

Protein (function)
CDPK3 belongs to an expanded family of Ca2+ dependent protein kinases (CDPKs). CDPKs combine an amino-terminal serine/threonine kinase domain and a carboxy-terminal calmodulin-like domain, composed of four EF hands, in the same molecule. In plants, CDPKs translate Ca2+ signals generated by external stimuli into cellular responses, thereby regulating cell division and differentiation, the development of tolerance to stress stimuli and the specific defense responses to pathogens.

Analyses of mutants lacking expression of CDPK3 (RMgm-154, RMgm-165, RMgm-168) indicates a role for CDPK3 in regulating productive gliding motility of ookinetes.

The following different genes encoding proteins with homology to cyclic nucleotide phosphodiesterase have been identified in Plasmodium

Phosphodiesterase α PFL0475w PB000578.00.0 cGMP-specific phosphodiesterase
Phosphodiesterase γ MAL13P1.119 PB000383.00.0 calcium/calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase 1b
Phosphodiesterase δ PF14_0672 PB000873.01.0 cyclic nucleotide phosphodiesterase, putative
Phosphodiesterase β MAL13P1.118 PB000520.03.0
PB001129.01.0
3',5'-cyclic nucleotide phosphodiesterase

Analyses of a mutant lacking expression of PDEδ (RMgm-308) indicate that PDEδ has a crucial role in ookinete development and motility.

Phenotype
See also the phenotype descriptions of mutants lacking expression of PDEδ (RMgm-308) or CDPK3 (RMgm-154).
Mature ookinetes showed the aberrant morphology as described for ookinetes lacking expression of only PDEδ. However, the gliding motility of immature ookinetes (12-15h) was not affected as has been found in ookinetes lacking expression of only CDPK3. The suppressed CDPK3 ko phenotype in the cdpk3 pdeδ double KO mutant suggests an interaction between cGMP and calcium dependent signalling pathways that regulate ookinete gliding (see also 'Additional information').

Additional information
In the paper evidence is presented that in ookinetes GCß is the main source for cGMP and that a cyclic GMP signalling module exists that regulates gliding motility of ookinetes. This evidence is partly based on the analysis of mutants lacking expression PDEδ (RMgm-308) and GCβ (RMgm-307) and a mutant  lacking expression of both GCβ and PDEδ (RMgm-309). These analyses indicate that PDEδ is the relevant cGMP degrading enzyme. Signalling via a cGMP-dependent protein kinase (PKG; PF14_0346; PB000726.02.0) may regulate ookinete differentiation and motility.

Disruption of the P. falciparum ortholog of PBANKA_040820 has been attempted (Solyakov et al., 2011, Nat Commun, 2:565).
The gene is likely essential for asexual proliferation. After transfection with a KO vector a weak PCR signal diagnostic for integration was observed, indicating that integration does transiently occur but parasites with a disrupted locus do not persist. Cloning will be required to validate this interpretation for this gene.


Other mutants
RMgm-154: A mutant lacking expression of CDPK3
RMgm-165: An independent mutant lacking expression of CDPK3
RMgm-168: A mutant lacking expression of CDPK3 and expressing GFP under control of the hsp70 promoter. This mutant has been generated by crossing mutant RMgm-165 lacking expression of CDPK3 with mutant RMgm-166 that expresses GFP.
RMgm-308: A mutant lacking expression of PDEδ
RMgm-12: A mutant lacking expression CDPK4



  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0408200
Gene Model P. falciparum ortholog PF3D7_0310100
Gene productcalcium-dependent protein kinase 3
Gene product: Alternative nameCDPK3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, BamHI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption 5' targetting region: a 608 bp fragment comprising 5′ upstream sequence followed by the first 543 bp of exon1 of cdpk3

3' targetting region: A 686 bp fragment comprising the last two exons and 3′ flanking region of pbcdpk3

No additional information on primer sequences is available.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationNo additional information on primer sequences used for the replacement construct is provided in the paper!

The cdpk3 gene has been disrupted using a construct that contains the tgdhfr selectable marker and that integrates by double cross-over recombination. This mutant has been described as mutant RMgm-154.
The pdeδ gene has been disrupted using a construct that contains the tgdhfr selectable marker and that integrates by double cross-over recombination. This mutant has been described as mutant RMgm-308.
The cdpk3 pdeδ double KO mutant was produced by crossing (in the mosquito) the cdpk3 KO mutant and the pdeδ KO mutant. Multiple clones were genotyped to identify and select the cdpk3 pdeδ double KO mutants.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1333700
Gene Model P. falciparum ortholog PF3D7_1470500
Gene productphosphodiesterase delta, putative
Gene product: Alternative namePDEδ, Phosphodiesterase delta
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, BamHI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe cdpk3 gene has been disrupted using a construct that contains the tgdhfr selectable marker and that integrates by double cross-over recombination. This mutant has been described as mutant RMgm-154.
The pdeδ gene has been disrupted using a construct that contains the tgdhfr selectable marker and that integrates by double cross-over recombination. This mutant has been described as mutant RMgm-308.
The cdpk3 pdeδ double KO mutant was produced by crossing (in the mosquito) the cdpk3 KO mutant and the pdeδ KO mutant. Multiple clones were genotyped to identify and select the cdpk3 pdeδ double KO mutants.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gcgggtaccgatattgtacgcaagtggtac
Additional information primer 1ol05 (KpnI); 5' flanking region
Sequence Primer 2gcgatcgatgaatatctgactcattcaagc
Additional information primer 2ol06 (HindIII); 5' flanking region
Sequence Primer 3gcggaattccggaatcctaaatgacaagtc
Additional information primer 3ol07 (EcoRI); 3' flanking region
Sequence Primer 4gcgactagtcctcatcaggtttttccatac
Additional information primer 4ol08 (BamHI); 3' flanking region
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6