Summary

RMgm-308
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1333700; Gene model (P.falciparum): PF3D7_1470500; Gene product: phosphodiesterase delta, putative (PDEδ, phosphodiesterase delta)
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 1 October 2009, 14:51
  *RMgm-308
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19779564
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherR.W. Moon; D.A. Baker; O. Billker
Name Group/DepartmentDepartment of Cell and Molecular Biology
Name InstituteImperial College London
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-308
Principal namepdeδ mutant
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteGametocyte production and fertilisation were not different from wild type. During the first 12h of in vitro culture, mutant zygotes differentiated into morphologically advanced ookinetes (stage IV-VI) in similar numbers as wild type. In cultures of wild ookinetes, mature ookinete forms continued to accumulate in in vitro culture, reaching 60% of all macrogamete-derived parasites by 24h, the remainder presumably being unfertilised macrogametes. In contrast, all the morphologically mature ookinetes in the early cultures (12h) of the mutant were replaced successively by stumpy and round forms and at 24h, hardly any typically shaped ookinetes were present. Motility of ookinetes was affected (see 'Additional information'). The mutant ookinetes had a greatly reduced capacity to develop into oocysts; oocyst numbers on the mosquito midgut epithelium were reduced by >94%.
OocystThe mutant ookinetes had a greatly reduced capacity to develop into oocysts; oocyst numbers on the mosquito midgut epithelium were reduced by >94%.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression cyclic nucleotide phosphodiesterase, putative (PDEδ, phosphodiesterase delta; cyclic nucleotide phosphodiesterase, putative).

Protein (function)
The following different genes encoding proteins with homology to cyclic nucleotide phosphodiesterase have been identified in Plasmodium

Phosphodiesterase α PFL0475w PB000578.00.0 cGMP-specific phosphodiesterase
Phosphodiesterase γ MAL13P1.119 PB000383.00.0 calcium/calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase 1b
Phosphodiesterase δ PF14_0672 PB000873.01.0 cyclic nucleotide phosphodiesterase, putative
Phosphodiesterase β MAL13P1.118 PB000520.03.0
PB001129.01.0
3',5'-cyclic nucleotide phosphodiesterase

Phenotype
The phenotype analyses indicate that the PDEδ has a crucial role in ookinete development and motility, resulting in failure of invasion of the midgut epithelium and the formation of oocysts. Analyses indicate indicate the lack of expression of PDEδ does not affect motor activity, but as a result of changed cellular morphology it reduced forward gliding which may explain the marked reduction in mosquito transmission of the ookinetes (see 'Additional information').

Additional information
Mutant ookinetes with normal morphology moved at speeds comparable to wild type, while round mutant ookinetes produced little or no forward motility. Conversely, rotational speed increased with the severity of the morphological defect, such that round mutant ookinetes were seen to rotate rapidly on the spot. These analyses indicate that disruption of pdeδ did not affect motor activity, but as a result of changed cellular morphology it reduced forward gliding which may explain the marked reduction in mosquito transmission of the ookinetes.

Aberrant differentiation of mutant ookinetes was not accompanied by parasite death, as judged by exclusion of the membrane impermeable SYTOX® green nucleic acid stain. In addition, injection of mutant ookinetes in the hemocoel, the ookinetes were able to produce oocysts and produced infective salivary gland sporozoites comparable to wild type ookinetes.

Ultrastructural analyses of mutant ookinetes indicated the presence of a 'discontinuous' inner membrane complex (IMC) with gaps that varied in size

In the paper evidence is presented that in ookinetes GCß is the main source for cGMP and that a cyclic GMP signalling module exists that regulates gliding motility of ookinetes. This evidence is partly based on the analysis of the mutant described here lacking expression PDEδ and a mutant lacking expression of both GCβ and PDEδ (RMgm-309). These analyses indicate that PDEδ is the relevant cGMP degrading enzyme. Signalling via a cGMP-dependent protein kinase (PKG; PF14_0346; PB000726.02.0) may regulate ookinete differentiation and motility.

Other mutants
RMgm-309: A mutant lacking expression of both PDEδ and guanylyl cyclase β (GCβ; (Gene models for GCß PB000752.03.0; PB300849.03.0; PB001059; MAL13P1.301).
RMgm-310: A mutant lacking expression of both PDEδ and CDPK3 (calcium-dependent protein kinase-3; PB000947.00.0;PFC0420w).


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1333700
Gene Model P. falciparum ortholog PF3D7_1470500
Gene productphosphodiesterase delta, putative
Gene product: Alternative namePDEδ, phosphodiesterase delta
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, BamHI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gcgggtaccgatattgtacgcaagtggtac
Additional information primer 1ol05 (KpnI); 5' flanking region
Sequence Primer 2gcgatcgatgaatatctgactcattcaagc
Additional information primer 2ol06 (HindIII); 5' flanking region
Sequence Primer 3gcggaattccggaatcctaaatgacaagtc
Additional information primer 3ol07 (EcoRI); 3' flanking region
Sequence Primer 4gcgactagtcctcatcaggtttttccatac
Additional information primer 4ol08 (BamHI); 3' flanking region
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6