Summary

RMgm-309
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1136700; Gene model (P.falciparum): PF3D7_1360500; Gene product: guanylyl cyclase beta (GCβ, guanylyl cyclase beta)
DisruptedGene model (rodent): PBANKA_1333700; Gene model (P.falciparum): PF3D7_1470500; Gene product: phosphodiesterase delta, putative (PDEδ, Phosphodiesterase delta)
Phenotype Fertilization and ookinete;
Last modified: 1 October 2009, 14:52
  *RMgm-309
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19779564
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherR.W. Moon; D.A. Baker; O. Billker
Name Group/DepartmentDepartment of Cell and Molecular Biology
Name InstituteImperial College London
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-309
Principal namegcβ pdeδ double KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal fertilisation rates and ookinete production. Mutant ookinetes had a greatly reduced gliding motility (speed) comparable to the reduced motility of ookinetes of a mutant lacking only GCß (RMgm-307). The morphology of ookinetes was comparable to that of wild type ookinetes and no aberrant ookinetes were observed as described for a mutant lacking only PDEδ (RMgm-308).
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of guanylyl cyclase β (GCß) and cyclic nucleotide phosphodiesterase, putative (PDEδ, phosphodiesterase delta; cyclic nucleotide phosphodiesterase, putative). The gcβ pdeδ double KO mutant was produced by crossing the gcβ KO mutant (RMgm-307) with the pdeδ KO mutant (RMgm-308).

Protein (function)
Two different genes with high homology to guanylyl cyclases (GCα and GCβ) have been identified in Plasmodium (guanylyl cyclase alpha: PF11_0395; PB001219.00.0, PB000256.00.0). Guanylyl cyclase β (GCß) contains a guanylate cyclase domain and an N-terminal P-type ATPase like domain. Analyses of mutants lacking expression of GCß (RMgm-169, RMgm-307) indicate that the GCß has a crucial role in ookinete motility.

 The following different genes encoding proteins with homology to cyclic nucleotide phosphodiesterase have been identified in Plasmodium

Phosphodiesterase α PFL0475w PB000578.00.0 cGMP-specific phosphodiesterase
Phosphodiesterase γ MAL13P1.119 PB000383.00.0 calcium/calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase 1b
Phosphodiesterase δ PF14_0672 PB000873.01.0 cyclic nucleotide phosphodiesterase, putative
Phosphodiesterase β MAL13P1.118 PB000520.03.0
PB001129.01.0
3',5'-cyclic nucleotide phosphodiesterase

Analyses of a mutant lacking expression of PDEδ (RMgm-308) indicate that PDEδ has a crucial role in ookinete development and motility.

Phenotype
See also the phenotype descriptions of mutants lacking expression of PDEδ (RMgm-308) or GCß (RMgm-307).

The mutant lacking expression of both PDEδ  and GCß produced ookinetes that were affected in motility, comparable to the reduced motility of ookinetes of a mutant lacking only GCß (RMgm-307). However, the morphology of ookinetes was comparable to that of wild type ookinetes and no aberrant ookinetes were observed as described for a mutant lacking only PDEδ (RMgm-308). The suppression in the 'double knock-out mutant' of the phenotype of aberrant ookinete morphology in the mutant lacking expression of only PDEδ supports a model in which both PDEδ and GCß operate in the same cGMP dependent pathway (see 'Additional information').


Additional information
(Gene models for GCß PB000752.03.0; PB300849.03.0; PB001059)

In the paper evidence is presented that in ookinetes GCß is the main source for cGMP and that a cyclic GMP signalling module exists that regulates gliding motility of ookinetes. This evidence is partly based on the analysis of mutants lacking expression PDEδ (RMgm-308) and GCβ (RMgm-307) and the mutant described here lacking expression of both GCβ and PDEδ. These analyses indicate that PDEδ is the relevant cGMP degrading enzyme. Signalling via a cGMP-dependent protein kinase (PKG; PF14_0346; PB000726.02.0) may regulate ookinete differentiation and motility.

Other mutants
RMgm-169 and RMgm-307: mutants lacking expression of GCβ
RMgm-308: A mutant lacking expression of PDEδ
RMgm-310: A mutant lacking expression of both PDEδ and CDPK3 (calcium-dependent protein kinase-3; PB000947.00.0;PFC0420w).


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1136700
Gene Model P. falciparum ortholog PF3D7_1360500
Gene productguanylyl cyclase beta
Gene product: Alternative nameGCβ, guanylyl cyclase beta
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ClaI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe gcβ gene has been disrupted using a construct that integrates by single cross-over integration (insertion vector) that contains the tgdhfr selectable marker. The disadvantage of using an insertion construct is that the construct can be removed from the genome, thereby restoring the wild type genotype. This mutant has been described as mutant RMgm-307.
The pdeδ gene has been disrupted using a construct that contains the tgdhfr selectable marker and that integrates by double cross-over recombination. This mutant has been described as mutant RMgm-308.
The gcβ pdeδ double KO mutant was produced by crossing (in the mosquito) the gcβ KO mutant (RMgm-307) with the pdeδ KO mutant (RMgm-308). Multiple clones were genotyped to identify and select the gcβ pdeδ double KO mutants.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1cccccgggccctatcgtttacactttgtttatgacggtg
Additional information primer 1ol278 (ApaI); 5' end GCβ locus (1Kb)
Sequence Primer 2ccccaagcttcaacaacaccatcaatatattcgg
Additional information primer 2ol279 (HindIII); 5' end GCβ locus (1Kb)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1333700
Gene Model P. falciparum ortholog PF3D7_1470500
Gene productphosphodiesterase delta, putative
Gene product: Alternative namePDEδ, Phosphodiesterase delta
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, BamHI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe gcβ gene has been disrupted using a construct that integrates by single cross-over integration (insertion vector) that contains the tgdhfr selectable marker. The disadvantage of using an insertion construct is that the construct can be removed from the genome, thereby restoring the wild type genotype. This mutant has been described as mutant RMgm-307.
The pdeδ gene has been disrupted using a construct that contains the tgdhfr selectable marker and that integrates by double cross-over recombination. This mutant has been described as mutant RMgm-308.
The gcβ pdeδ double KO mutant was produced by crossing (in the mosquito) the gcβ KO mutant (RMgm-307) with the pdeδ KO mutant (RMgm-308). Multiple clones were genotyped to identify and select the gcβ pdeδ double KO mutants.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gcgggtaccgatattgtacgcaagtggtac
Additional information primer 1ol05 (KpnI); 5' flanking region
Sequence Primer 2gcgatcgatgaatatctgactcattcaagc
Additional information primer 2ol06 (HindIII); 5' flanking region
Sequence Primer 3gcggaattccggaatcctaaatgacaagtc
Additional information primer 3ol07 (EcoRI); 3' flanking region
Sequence Primer 4gcgactagtcctcatcaggtttttccatac
Additional information primer 4ol08 (BamHI); 3' flanking region
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6