Summary

RMgm-307
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1136700; Gene model (P.falciparum): PF3D7_1360500; Gene product: guanylyl cyclase beta (GCβ, guanylyl cyclase beta)
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 1 October 2009, 13:32
  *RMgm-307
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19779564
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherR.W. Moon; D.A. Baker; O. Billker
Name Group/DepartmentDepartment of Cell and Molecular Biology
Name InstituteImperial College London
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-307
Principal namegcβ mutant
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal fertilisation rates and ookinete production. Ookinetes had a strongly reduced capacity to develop into oocysts (an oocyst production in Anopheles stephensi of only 2.2% of wild type oocysts). Mutant ookinetes had a greatly reduced gliding motility (speed).
OocystOokinetes had a strongly reduced capacity to develop into oocysts (an oocyst production in Anopheles stephensi of only 2.2% of wild type oocysts). Mutant ookinetes had a greatly reduced gliding motility (speed).
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of guanylyl cyclase β (GCß).

Protein (function)
Two different genes with high homology to guanylyl cyclases (GCα and GCβ) have been identified in Plasmodium (guanylyl cyclase alpha: PF11_0395; PB001219.00.0, PB000256.00.0).
Guanylyl cyclase β (GCß) contains a guanylate cyclase domain and an N-terminal P-type ATPase like domain.

Phenotype
The phenotype analyses indicate that the GCß has a crucial role in ookinete motility, resulting in failure of invasion of the midgut epithelium and the formation of oocysts. This phenotype is similar to the phenotype of an independent mutant lacking expression of GCß (RMgm-169). See further 'Additional information'.

Additional information
In the paper evidence is presented that in ookinetes GCß is the main source for cGMP and that a cyclic GMP signalling module exists that regulates gliding motility of ookinetes. This evidence is partly based on the analysis of a mutant lacking expression of a cyclic nucleotide degrading phosphodiesterase (PDEδ; RMgm-308) and a mutant lacking expression of both GCβ and PDEδ (RMgm-309). These analyses indicate that PDEδ is the relevant cGMP degrading enzyme. Signalling via a cGMP-dependent protein kinase (PKG; PF14_0346; PB000726.02.0) may regulate ookinete differentiation and motility.

Injection of the mutant ookinetes into the hemocoel of mosquitoes did not result in formation of salivary gland sporozoites, suggesting that GCß may have an additional function.

In the same paper it is reported that repeated attempts were made to disrupt the guanylyl cyclase-α gene (GCα; Guanylyl cyclase alpha: PB001219.00.0, PB000256.00.0; PF11_0395). These attempts were unsuccessful (see RMgm-324), suggesting its essential role in the blood stage parasites (no information is provided on the construct used to disrupt GCα and the sequence of primers used to amplify the target regions).

An independent unsuccessful attempt to disrupt the guanylyl cyclase-α gene is described in RMgm-323.

(Gene models for GCß PB000752.03.0; PB300849.03.0; PB001059)

Other mutants
RMgm-169: An independent mutant lacking expression of GCβ
RMgm-309: A mutant lacking expression of both GCβ and PDEδ (PB000873.01.0; PF14_0672; cyclic nucleotide phosphodiesterase, putative).
RMgm-323 and RMgm-324; Unsuccessful attempts to disrupt GCα; Guanylyl cyclase alpha: PB001219.00.0, PB000256.00.0; PF11_0395


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1136700
Gene Model P. falciparum ortholog PF3D7_1360500
Gene productguanylyl cyclase beta
Gene product: Alternative nameGCβ, guanylyl cyclase beta
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ClaI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe gcβ gene has been disrupted using a construct that integrates by single cross-over integration (insertion vector) that contains the tgdhfr selectable marker. The disadvantage of using an insertion construct is that the construct can be removed from the genome, thereby restoring the wild type genotype.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1cccccgggccctatcgtttacactttgtttatgacggtg
Additional information primer 1ol278 (ApaI); 5' end GCβ locus (1Kb)
Sequence Primer 2ccccaagcttcaacaacaccatcaatatattcgg
Additional information primer 2ol279 (HindIII); 5' end GCβ locus (1Kb)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6