Summary

RMgm-169
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1136700; Gene model (P.falciparum): PF3D7_1360500; Gene product: guanylyl cyclase beta (GCβ, guanylyl cyclase beta)
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 21 September 2009, 17:41
  *RMgm-169
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 17030505
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherM. Hirai; H. Matsuoka
Name Group/DepartmentDivision of Medical Zoology, Department of Infection and Immunity
Name InstituteJichi Medical University School of Medicine
CityTochigi
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-169
Principal namegcβko
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal fertilisation rates and ookinete production. Ookinetes are not able to penetrate the cells of the midgut wall. The motility of ookinetes was reduced. The moving velocity of mutant parasites was much slower than that of wild type (wild type = 5.7 ± 1.4 µm/min, mutant = 0.6 ± 0.1µm/min)
OocystNo oocyst formation.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of guanylyl cyclase β (GCß).

Protein (function)
Two different genes with high homology to guanylyl cyclases (GCα and GCβ) have been identified in Plasmodium (guanylyl cyclase alpha: PF11_0395; PB001219.00.0, PB000256.00.0).
Guanylyl cyclase β (GCß) contains a guanylate cyclase domain and an N-terminal P-type ATPase like domain.

Phenotype
The phenotype analyses indicate that the GCß has a crucial role in ookinete motility, resulting in failure of invasion of the midgut epithelium. Mutant ookinetes remained on the surface of the microvilli.
In vitro cultured ookinetes were able to develop in vitro into oocysts and sporozoites indicating that the lack of GCß affects ookinete motility but not later development of the parasites.

Additional information
In the same paper it is reported that repeated attempts were made to disrupt the guanylyl cyclase-α gene (GCα; Guanylyl cyclase alpha: PB001219.00.0, PB000256.00.0; PF11_0395). These attempts were unsuccessful (see RMgm-323), suggesting its essential role in the blood stage parasites (no information is provided on the construct used to disrupt GCα and the sequence of primers used to amplify the target regions).

An independent unsuccessful attempt to disrupt the guanylyl cyclase-α gene is described in RMgm-324.

(Gene models for GCß PB000752.03.0; PB300849.03.0; PB001059)

Other mutants
Other mutants
RMgm-307: An independent mutant lacking expression of GCβ
RMgm-309: A mutant lacking expression of both GCβ and PDEδ (PB000873.01.0; PF14_0672; cyclic nucleotide phosphodiesterase, putative).
RMgm-323 and RMgm-324; Unsuccessful attempts to disrupt GCα; Guanylyl cyclase alpha: PB001219.00.0, PB000256.00.0; PF11_0395


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1136700
Gene Model P. falciparum ortholog PF3D7_1360500
Gene productguanylyl cyclase beta
Gene product: Alternative nameGCβ, guanylyl cyclase beta
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ClaI/EcoRI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Most of the Transmembrane domain (TM) and both catalytic sites of guanylate cyclase were disrupted. Part of the TM remained
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAGCTTCATTTATCCAATACCCTG
Additional information primer 1GCß–F1-HindIII; 5'
Sequence Primer 2AAGCTTATTTCCAATAAGTACCC
Additional information primer 2GCß-R1-HindIII; 5'
Sequence Primer 3GAATTCGTGTGTTGGAGGAATTATAG
Additional information primer 3GCß–F2-EcoRI; 3'
Sequence Primer 4GGATCCTCGTAGTTTATAATTTTGG
Additional information primer 4GCß–R2-BamHI; 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6