RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-324
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0910300; Gene model (P.falciparum): PF3D7_1138400; Gene product: guanylyl cyclase (Guanylyl cyclase alpha, GCα)
PhenotypeNo phenotype has been described
Last modified: 13 October 2009, 15:54
  *RMgm-324
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification Unknown
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19779564
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherR.W. Moon; D.A. Baker; O. Billker
Name Group/DepartmentDepartment of Cell and Molecular Biology
Name InstituteImperial College London
CityLondon
CountryUK
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0910300
Gene Model P. falciparum ortholog PF3D7_1138400
Gene productguanylyl cyclase
Gene product: Alternative nameGuanylyl cyclase alpha, GCα
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedUnknown
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption An attempt was made to disrupt both PB001219.00.0 and PB000256.00.0 at once
Selectable marker used to select the mutant parasiteUnknown
Promoter of the selectable markerUnknown
Selection (positive) procedureUnknown
Selection (negative) procedureUnknown
Additional remarks genetic modificationIn the paper it is reported that repeated attempts were made to disrupt the gene. No information/details is provided on the number of attempts to disrupt the gene and the construct used to disrupt the gene.

An independent unsuccessful attempt to disrupt the guanylyl cyclase-α gene is described in RMgm-323.

(gene models GCα: PB001219.00.0, PB000256.00.0)

Two different genes with high homology to guanylyl cyclases (GCα and GCβ) have been identified in Plasmodium (GCβ, guanylyl cyclase beta; Gene models for GCß PB000752.03.0; PB300849.03.0; PB001059)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TGGTAGTATGAAAAATCAGGATAGC
Additional information primer 15’ region of homology Fwd
Sequence Primer 2AATACTACCTACAGTTAATTCCATCC
Additional information primer 25’ region of homology Rev
Sequence Primer 3TGTGCTATATGCATGTTATACATCG
Additional information primer 33’ region of homology Fwd
Sequence Primer 4GGATAAAGTCATGCACTGTGGAC
Additional information primer 43’ region of homology Rev
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren