RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1600
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0402600; Gene model (P.falciparum): PF3D7_0304000; Gene product: inner membrane complex protein 1a, putative (IMC1a, ALV1)
Details mutation: A frame shift near the 5'end of the coding sequence
TaggedGene model (rodent): PBANKA_0402600; Gene model (P.falciparum): PF3D7_0304000; Gene product: inner membrane complex protein 1a, putative (IMC1a, ALV1)
Name tag: mCherry
Phenotype Oocyst; Sporozoite;
Last modified: 25 July 2022, 12:14
  *RMgm-1600
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation, Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25185663
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherTremp, AZ; Dessens JT
Name Group/DepartmentPathogen Molecular Biology Department, Faculty of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene and Tropical Medicine
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-1600
Principal nameIMC1a/mCherry-KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal oocyst production and numbers of (hemocoel)sporozoites are comparable to wild type. No salivary gland sporozoites. Sporozoites show abnormal size and shape.
SporozoiteNormal oocyst production and numbers of (hemocoel)sporozoites are comparable to wild type. No salivary gland sporozoites. Sporozoites show abnormal size and shape.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mutated version of IMC1a that is C-terminal tagged with mCherry. The mutated version contains a frame shift near the 5' end of the coding sequence. This frame shift results in a functional knock-out of IMC1a. The phenotype is comparable to the phenotype with a disrupted imc1a gene (RMgm-148).

Protein (function)
In Plasmodium eight conserved IMC1 protein family members have been identified, named IMC1a-IMC1h. Two of these, IMC1a and IMC1b, were shown to be differentially expressed in sporozoites and ookinetes, respectively, and to form part of their pellicle structures in P. berghei. IMC1a and IMC1b are structurally and functionally homologous and involved in parasite morphology, mechanical strength, gliding motility and infectivity, in accordance with their roles as membrane skeleton proteins (see also mutanst RMgm-147 and RMgm-148 lacking expression of IMC1b and IMC1a).
The zoites of Plasmodium, as well as those of related apicomplexan parasites, possess an unusual cortical structure termed the pellicle. The pellicle is defined by adouble membrane structure termed the inner membrane complex(IMC) situated directly underneath the plasma membrane, whichis equivalent to a system of flattened sacs or alveoli. On the cytoplasmic face of the IMC is anchored a network of intermediate filaments termed the subpellicular network (SPN), the function of which is to support the pellicle membranes and give the cell mechanical strength.
A family of proteins now termed alveolins have been identified as components of the SPN. In the genus Plasmodium, 13 conserved and syntenic alveolin family members have been identified that are dif-ferentially expressed among the three different zoites stages of malaria parasites. The alveolins identified in Plasmodium are characterised by having one or more highly conserved domains separated by regions of variable length and amino acid composition. Apart from the conserved alveolin domains, a subset of the alveolins also possess conserved cysteine motifs close to their amino- or carboxy-terminus. These motifs are made up of a single cysteine and a double cysteine that are separated by a small number of other amino acids. With the exception of IMC1i, The N-and C-terminal motifs are inverted, with the single cysteine located nearest the end of the polypeptide. The function of these cysteine motifs is largely unknown, although they have been suggested to provide sites for post-translational S-palmitoylation.
IMC1a is the only Plasmodium alveolin with conserved cysteine motifs at both ends, and in this study  site-directed mutagenesis and allelic replacement in P. berghei was emplyed to investigate the contribution of these motifs to the function of theprotein and the SPN as a whole.

Phenotype
The mutant expresses a mutated version of IMC1a that is C-terminal tagged with mCherry. The mutated version contains a frame shift near the 5' end of the coding sequence. This frame shift results in a functional knock-out of IMC1a. The phenotype is comparable to the phenotype with a disrupted imc1a gene (RMgm-148).
Normal oocyst production and numbers of (hemocoel)sporozoites are comparable to wild type. No salivary gland sporozoites. Sporozoites show abnormal size and shape.

Additional information
To study expression and localization of IMC1a and variants of it in the parasite, first  a transgenic P. berghei line was generated that expresses full-length IMC1a fused to a carboxy-terminal mCherrytag (RMgm-1597), named IMC1a/mCherry-WT. To study the contribution of the cysteine motifs to IMC1a function, mutations substituting the three cysteines were introduced by site-directed mutagenesis removing either the N-terminal motif (named IMC1a/mCherry-Mutant 1; RMgm-1598) or the C-terminal motif (named IMC1a/mCherry-Mutant2; RMgm-1599). The mutations introduced a diagnostic XhoI restriction site in order to screen targeting vectors and transgenic parasitesfor the presence of the desired mutation. Introduction of this XhoI site changes the double cysteine (CC) to a leucine-glutamate (LE). In addition, an IMC1a/mCherry targeting vector that contained a frame shift very near the 5' end of the coding sequence was used to generate a new IMC1a null mutant parasite line  (named IMC1a/mCherry-KO; RMgm-1600) using the same genetic approach as the other IMC1a lines.
In addition, two more mutants of the carboxy-terminal cysteine motif in IMC1a were generated, in which either its di-cysteine (named IMC1a/mCherry-Mutant 3) or its single cysteine (named IMC1a/mCherry-Mutant 4) were substituted

Evidence is presented that:
- The terminal cysteine motifs of IMC1a affect protein stability
- The terminal cysteine motifs of IMC1a affect sporozoite shape
- The terminal cysteine motifs of IMC1a affect sporozoiteinfectivity
- Properties of the carboxy-terminal cysteine motif aredetermined by the di-cysteine

Other mutants
See above
 


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0402600
Gene Model P. falciparum ortholog PF3D7_0304000
Gene productinner membrane complex protein 1a, putative
Gene product: Alternative nameIMC1a, ALV1
Details of the genetic modification
Short description of the mutationA frame shift near the 5'end of the coding sequence
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo allow mCherry tagging of IMC1a, an approximately 3.5 kb fragment corresponding to the entire imc1a gene (introns included) plus 5'-UTR was PCR amplified from P. berghei gDNA using primers pDNR-imc1a-F (ACGAAGTTATCAGTCGAGGTAC-CTTTCATGATTCTATCTATTGTTAATTTTAATTG) and pDNR-imc1a-R (ATGAGGGCCCCTAAGCTTTTATCTTGATTACAAAAATAATTACAA-CATTTG) and introduced into SalI/HindIII-digested pDNR-mCherry by in-fusion to give plasmid pDNR-IMC1a/mCherry.
To substitute the N-terminal cysteine motif of IMC1a (Mutant 1) primers IMC1a-Mut1-F (GAAAATAAATAGTAATCTC-GAGCATGATGAGTTGGGAGAAGACA) and IMC1a-Mut1-R(ATTACTATTTATTTTCCATGCATCAAACATTTTAATTAAATG) were used to PCR amplify pDNR-IMC1a/mCherry, and the PCR product was circularized by in-fusion to give plasmid pDNR-IMC1a-Mutant 1. Introduction of a diagnostic XhoI site changes the double cysteine (CC) in the amino-terminal motif to leucine-glutamate (LE). To substitute the C-terminal cysteine motif of IMC1a (Mutant 2) primers IMC1a-Mut2-F (CTCGAGAAT-TATTTTTGGAATCAAGATAAAAGCTTAGGGGC) and IMC1a-Mut2-R (CCAAAAATAATTCTCGAGTTTGTCTTCAGAATTATCACTTTTTTTT) were used to PCR amplify pDNR-IMC1a/mCherry, and the PCR product was circularized by in-fusion to give plasmid pDNR-IMC1a-Mutant 2. Introduction of a diagnostic XhoI site changes the double cysteine (CC) in the carboxy-terminal motif to leucine-glutamate (LE). To substitute the double cysteine from the C-terminal cysteine motif of IMC1a (Mutant 3) primers IMC1a-Mut3-F (CTCGAGAATTATTTTTGTAATCAAGATAAAAGCTTAGGGGC) andIMC1a-Mut3-R (ACAAAAATAATTCTCGAGTTTGTCTTCAGAATTAT-CACTTTTTTTT) were used to PCR amplify pDNR-IMC1a/mCherry, and the PCR product was circularized by in-fusion to give plasmid pDNR-IMC1a-Mutant 3. This mutation introduces a diagnostic XhoI restriction site, changing the double cysteine (CC) in the carboxy-terminal motif to leucine-glutamate (LE). To substitute the single cysteine from the C-terminal cysteine motif of IMC1a (Mutant 4) primers IMC1a-Mut4-F (TTATTTCGCGAATCAAGATAAAAGCTTAGGGGC) and IMC1a-Mut4-R (TTGATTCGCGAAATAATTACAACATTTGTCTTCAGAATTATCACT) were used to PCR amplify pDNR-IMC1a/mCherry, and the PCR product was circularized by in-fusion to give plasmid pDNR-IMC1a-Mutant 4. This mutation introduces a diagnostic NruI restriction site, changing the single cysteine (C) in the carboxy-terminal motif to alanine (A)
Primers hDHFR/ERI-F (ACAAAGAATTCATG-GTTGGTTCGCTAAACT) and hDHFR/ERI-R (ACCATGAATTCTTTGTAACATTTAGGTGTGTATTTATATATATAAGC) were used to PCR amplify plasmid pLP-hDHFR. The PCR product was circularized by in-fusion, to give plasmid pLP-hDHFR/EcoRI. In this plasmid the BamHI restriction site at beginning of the hDHFR gene is replaced with an EcoRI recognition sequence. A 1.7 kb fragment corresponding to the hdhfr-yfcu gene was PCR amplified from plasmid pL0035 with primers hDHFRyFCU-F (ATGTTA-CAAAGAATTCATGGTTGGTTCGCTAAACTG) and hDHFRyFCU-R (AAGAAAAACGGGATCCTTAAACACAGTAGTATCTGTCACCAAAG) and introduced into EcoRI/BamHI-digested pLP-hDHFR/EcoRI by in-fusion to give pLP-hDHFRyFCU. A 0.75 kb fragment corresponding to the 3'UTR of the imc1a gene was amplified from P. berghei gDNA with primers pLP-imc1a-F (ATATGCTAGAGCG-GCCAAAATATGGTATTTTAAAACTATTGAATTGG) and pLP-imc1a-R (CACCGCGGTGGCGGCCAGCGACACTTAAGAGATAGCATAAGA) and introduced into NotI-digested pLP-hDHFRyFCU by in-fusion to give plasmid pLP-hDHFRyFCU/IMC1a. Creloxp recombination of pDNR-IMC1a/mCherry, pDNR-IMC1a-Mutant 1 and pDNR-IMC1a-Mutant 2, pDNR-IMC1a-Mutant3 and pDNR-IMC1a-Mutant 4 was carried out with pLP-hDHFRyFCU/IMC1a to give the final targeting vectors pLP-IMC1a/mCherry-WT, pLP-IMC1a/mCherry-Mutant 1 to pLP-IMC1a/mCherry-Mutant 4, respectively.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0402600
Gene Model P. falciparum ortholog PF3D7_0304000
Gene productinner membrane complex protein 1a, putative
Gene product: Alternative nameIMC1a, ALV1
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6