Summary

RMgm-148
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0402600; Gene model (P.falciparum): PF3D7_0304000; Gene product: inner membrane complex protein 1a, putative (IMC1a, inner membrane complex protein 1a)
Phenotype Sporozoite; Liver stage;
Last modified: 15 January 2011, 22:12
  *RMgm-148
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 15533999
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherE.I. khater; R.E. Sinden; J.T. Dessens
Name Group/DepartmentDepartment of Biological Sciences
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-148
Principal nameIMC1a-KO (clone 104, 204)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteOocysts appeared to develop normally and formed large numbers of sporozoites. However, closer examination of these sporozoites revealed that they were of abnormal shape and some 20–30% smaller in size. Each sporozoite possessed a single enlarged, protruding area associated with the position of the nucleus. The position of these protrusions varied between sporozoites from being located at the posterior end to being positioned near the middle of the sporozoite.
The mutant sporozoites accumulated in the hemolymph and did not invade the salivary glands.
Gliding motility was strongly reduced. Mutant sporozoites were able to attach normally to the glass surface and undergo circular gliding, but their gliding speed was fivefold slower than that of wild type sporozoites.
Inoculation of purified oocyst-derived/hemolymph sporozoites into mice did not result in infection of the mice.
Liver stageInoculation of purified oocyst-derived/hemolymph sporozoites into mice did not result in infection of the mice.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of IMC1a (inner membrane complex protein 1a).

Protein (function)
The imca1a gene belongs to small 'family' of conserved genes that express putative membrane skeleton proteins which contain domains that share sequence homology to domains of articulins, proteins of membrane skeleton of free-living protists and show homology to the inner membrane complex protein 1 (TgIMC1) of the subpellicular network of Toxoplasma gondii tachyzoites (Khater, E.I., et al. 2004, J. Cell. Biol. 167, 425-32) . The pellicle of invasive stages of Plasmodium is composed of the plasma membrane and a tightly associated inner membrane complex.

Phenotype
The phenotype analyses indicate a role in the shape and motility (and invasion of  cells) of sporozoites and indicate a membrane skeletal role of IMC1a.

Additional information
RT-PCR analyses and immuno-fluorescence analysis of expression using polyclonal antiserum indicate that expression occurs predominantly in the mature oocyst and sporozoite stage.
Mutant sporozoites were more sensitive to hypo-osmotic conditions, indicating that IMC1a is involved in the mechanical stability of sporozoites, which is consistent with its role as an sporozoite membrane skeleton component.
Ultrastructural examination of sporulating oocysts showed sporozoites being less homogeneous in shape and size than wild type sporozoites and arranged in a more disorganized fashion inside the oocyst. Developing sporozoites in the process of budding from the sporoblast already appeared to possess the enlarged area around the nucleus, indicating that the effect of the the absence of IMC1a on cell shape occurs during or before this event. Apart from these visible abnormalities, mutant sporozoites appeared to possess a complete set of organelles and the assembly of subpellicular microtubules and inner membrane complex appeared unaffected by the gene disruption.
GenBank accession number: AF542052.

Other mutants
RMgm-147: A mutant lacking expression of IMC1b (inner membrane complex protein 1b)
RMgm-163: A mutant expressing a GFP-tagged form of IMC1b
RMgm-600: A mutant expressing a GFP-tagged form of IMC1h
RMgm-601: A mutant lacking expression of IMC1h
RMgm-602: A mutant lacking expression of both IMC1h and IMC1b


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0402600
Gene Model P. falciparum ortholog PF3D7_0304000
Gene productinner membrane complex protein 1a, putative
Gene product: Alternative nameIMC1a, inner membrane complex protein 1a
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/NotI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption A modified T. gondii dihydrofolate reductase/thymidylate synthase (DHFR/TS) gene cassette (conferring resistance to pyrimethamine) was inserted into the imc1a gene by double homologous recombination replacing nucleotides 550–2,404 of the imc1a gene
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGTACCGTTAGAGTTTGTGATTTC
Additional information primer 1P13F-KpnI; 5'
Sequence Primer 2AAGCTTCTGGAACCTCCACAAC
Additional information primer 2P13R-HindIII; 5'
Sequence Primer 3TCTAGAGGATATCTACAGATAC
Additional information primer 3P14F-XbaI; 3'
Sequence Primer 4GCGGCCGCTAAGAATGTGTATAC
Additional information primer 4P14R-NotI; 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6