RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-147
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0907100; Gene model (P.falciparum): PF3D7_1141900; Gene product: inner membrane complex protein 1b, putative (IMC1b, inner membrane complex protein 1b)
Transgene
 Transgene not Plasmodium: EGFP
Promoter: Gene model: PBANKA_0907100; Gene model (P.falciparum): PF3D7_1141900; Gene product: inner membrane complex protein 1b, putative (IMC1b, inner membrane complex protein 1b)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0907100; Gene product: inner membrane complex protein 1b
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 15 January 2011, 22:10
  *RMgm-147
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18650444
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/ResearcherA.Z. Tremp; J.T. Dessens
Name Group/DepartmentDepartment of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene and Tropical Medicine
CityLondon
CountryUnited Kingdom
top of page
Name of the mutant parasite
RMgm numberRMgm-147
Principal nameIMC1b-KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of ookinetes are produced. The morphology/shape of ookinetes appeared abnormal. Compared with WT ookinetes, IMC1b-KO ookinetes were typically shorter (mean length 10.76 ± 0.15 µm for WT; 9.27 ± 0.10 µm for IMC1b-KO; n = 100), and wider (mean width 1.98 ± 0.03 µm for WT; 2.67 ± 0.05 µm for IMC1b-KO; n = 100). In particular, IMC1b-KO ookinetes possessed a bulging area typically in the central part of the cell.
Gliding motility of ookinetes was markedly (~4 fold) reduced compared to wild type ookinetes.
Mutant ookinetes were more sensitive to hypo-osmotic conditions.
Ookinetes produced 8-10 times less oocysts.
OocystOokinetes produced 8-10 times less oocysts. Oocysts formed showed normal morphology and development and produced normal numbers of infectious sporozoites.
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of IMC1b (inner membrane complex protein 1b) and expresses GFP under the control of the promoter of imcb1b.

Protein (function)
The imcb1b gene belongs to small 'family' of conserved genes that express putative membrane skeleton proteins which contain domains that share sequence homology to domains of articulins, proteins of membrane skeleton of free-living protists and show homology to the inner membrane complex protein 1 (TgIMC1) of the subpellicular network of Toxoplasma gondii tachyzoites (Khater, E.I., et al. 2004, J. Cell. Biol. 167, 425-32) .   

Phenotype
The phenotype analyses indicate a role in the shape and motility (and invasion of midgut cells) of ookinetes. In combination with the location of IMC1b in the pellicle of ookinetes (see RMgm-163), these analyses indicate a membrane skeletal role of IMC1b. The pellicle of invasive stages of Plasmodium is composed of the plasma membrane and a tightly associated inner membrane complex. The (reduced)  formation of oocysts that produce infectious sporozoites indicate that IMC1b is not essential for P. berghei.

Additional information
RT-PCR analyses and analysis of expression of a GFP-tagged version of IMC1b (see RMgm-163) indicate that expression occurs predominantly in the ookinete stage.
Mutant ookinetes were more sensitive to hypo-osmotic conditions, indicating that IMC1b is involved in the mechanical stability of ookintes, which is consistent with its role as an ookinete membrane skeleton component.

Other mutants
RMgm-163: A mutant expressing a GFP-tagged form of IMC1b
RMgm-148: A mutant lacking expression of IMC1a (inner membrane complex protein 1a)
RMgm-600: A mutant expressing a GFP-tagged form of IMC1h
RMgm-601: A mutant lacking expression of IMC1h
RMgm-602: A mutant lacking expression of both IMC1h and IMC1b

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0907100
Gene Model P. falciparum ortholog PF3D7_1141900
Gene productinner membrane complex protein 1b, putative
Gene product: Alternative nameIMC1b, inner membrane complex protein 1b
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/SacII
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption A genetically modified P. berghei parasite was constructed in which all of the imc1b coding sequence was removed except for the first 30 residues
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe imc1b coding sequence was removed and replaced by the tgdhfr and a copy of gfp under control of the native imc1b gene promoter.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ACGAAGTTATCAGTCGACGGTACCATTGAGACGTTACGTATTAATTGTG
Additional information primer 1pDNR-IMC1b-F (imc1b 5'utr + coding sequence)
Sequence Primer 2ATGAGGGCCCCTAAGCTTGTATTTGTTTTCAATTGAGAAATGG
Additional information primer 2pDNR-IMC1b-R (imc1b 5'utr + coding sequence)
Sequence Primer 3TAACCATTGGTCATAAAAAAGGAACTGAAACAGGATA
Additional information primer 3pLP-IMC1b-F (imc1b 3'utr)
Sequence Primer 4CGGCCGCTCTAGCATACTACTTAAATAATATTTATTTCCTTTAGTGTGAA
Additional information primer 4pLP-IMC1b-R (imc1b 3'utr)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameEGFP
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe construct used to disrupt imcb1 contains the egfp gene as a reporter. The disruption of imcb1 results in the introduction of egfp under the control of the imcb1 promoter.
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0907100
Gene Model P. falciparum ortholog PF3D7_1141900
Gene productinner membrane complex protein 1b, putative
Gene product: Alternative nameIMC1b, inner membrane complex protein 1b
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0907100
Gene productinner membrane complex protein 1b
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren