Back to search resultsSummaryRMgm-1250
|
||||||||
*RMgm-1250| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25900212 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 2.34 |
| Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | S. Saeed; V. Carter; J.T. Dessens |
| Name Group/Department | Department of Infectious and Tropical Diseases |
| Name Institute | London School of Hygiene & Tropical Medicine |
| City | London |
| Country | UK |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1250 |
| Principal name | PbLAP3/KO |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not tested |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Normal ookinete production. However, ookinetes lack crystalloid bodies |
| Oocyst | Not different from wild type |
| Sporozoite | Strongly reduced sporozoite formation inside oocysts (the large majority of oocysts (~98%) failed to produce sporozoites). No infection of mice through the bite of infected mosquitoes |
| Liver stage | Not different from wild type |
| Additional remarks phenotype | Mutant/mutation Additional information Phenotype analyses of mutants lacking expression of different members of the LCCL domain-containing protein family (for example see LAP1/CCp3 RMgm-113, RMgm-114; LAP2/CCp1 RMgm-118, RMgm-121; LAP4/CCp2 RMgm-119; LAP6; CCp4 RMgm-120) indicate a role of several these proteins during oocyst development and sporozoite formation/production. |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0204500 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0109100 | ||||||||||||||||||||||||
| Gene product | LCCL domain-containing protein | ||||||||||||||||||||||||
| Gene product: Alternative name | LAP3; LCCL/lectin adhesive-like protein 2; CCp5 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | Plasmid pLP-PbLAP3/EFGP (RMgm-356) served as a template for inverse PCR using primers LAP3-KO-F (50ATTCAAAAAGCTTAGGGGCCCTCAT30) and LAP3-KO-R (50CCTAAGCTTTTTGAATATATTAAAATGGTTGTAATAACCA30). The amplified plasmid DNA was circularised via In-Fusion cloning (Takara Bio, Japan), resulting in the transfection construct pLP-PbLAP3-KO, in which all but the first 21 codons of P. berghei LAP3 (pblap3) have been removed. The plasmid were linearised with HindIII and SacII restriction enzymes to remove the vector backbone. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||