SummaryRMgm-1250
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25900212 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 2.34 |
Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | S. Saeed; V. Carter; J.T. Dessens |
Name Group/Department | Department of Infectious and Tropical Diseases |
Name Institute | London School of Hygiene & Tropical Medicine |
City | London |
Country | UK |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-1250 |
Principal name | PbLAP3/KO |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not tested |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Normal ookinete production. However, ookinetes lack crystalloid bodies |
Oocyst | Not different from wild type |
Sporozoite | Strongly reduced sporozoite formation inside oocysts (the large majority of oocysts (~98%) failed to produce sporozoites). No infection of mice through the bite of infected mosquitoes |
Liver stage | Not different from wild type |
Additional remarks phenotype | Mutant/mutation Additional information Phenotype analyses of mutants lacking expression of different members of the LCCL domain-containing protein family (for example see LAP1/CCp3 RMgm-113, RMgm-114; LAP2/CCp1 RMgm-118, RMgm-121; LAP4/CCp2 RMgm-119; LAP6; CCp4 RMgm-120) indicate a role of several these proteins during oocyst development and sporozoite formation/production. |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0204500 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0109100 | ||||||||||||||||||||||||
Gene product | LCCL domain-containing protein | ||||||||||||||||||||||||
Gene product: Alternative name | LAP3; LCCL/lectin adhesive-like protein 2; CCp5 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | Plasmid pLP-PbLAP3/EFGP (RMgm-356) served as a template for inverse PCR using primers LAP3-KO-F (50ATTCAAAAAGCTTAGGGGCCCTCAT30) and LAP3-KO-R (50CCTAAGCTTTTTGAATATATTAAAATGGTTGTAATAACCA30). The amplified plasmid DNA was circularised via In-Fusion cloning (Takara Bio, Japan), resulting in the transfection construct pLP-PbLAP3-KO, in which all but the first 21 codons of P. berghei LAP3 (pblap3) have been removed. The plasmid were linearised with HindIII and SacII restriction enzymes to remove the vector backbone. | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |