Summary

RMgm-113
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1035200; Gene model (P.falciparum): PF3D7_1407000; Gene product: LCCL domain-containing protein | scavenger receptor-like protein (PbSR; P. berghei Scavenger Receptor-like protein; PSLAP; LAP1; CCp3)
Phenotype Oocyst; Sporozoite;
Last modified: 18 February 2009, 12:40
  *RMgm-113
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 12354219
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherC. Claudianos, R.E. Sinden
Name Group/DepartmentDepartment of Biological Sciences
Name InstituteImperial college of Science Technology and Medicine
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-113
Principal namePbSR ko 5; PbSR ko 6
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of oocysts are formed. Mutant oocysts did not produce any sporozoites. Analysis of the nuclear organization of the mutant oocysts by DNA staining showed similar developmental progression to that in wild-type oocysts. No evidence was found of cytokinesis and subsequent sporozoite formation.
SporozoiteNo sporozoites are formed within the oocysts.
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PbSR (P. berghei Scavenger Receptor-like protein; PSLAP; LAP1; LCCL domain containing protein CCp3).

Protein (function)
The pbsr gene is a member of a small conserved gene family, encoding proteins with multiple adhesive domains, for example a Lgl1 (LCCL)-lectin adhesive domain. In P. falciparum the LCCL domain-containing proteins are termed PfCCp's. PbSR contains four LCCL domains; a LH2 (lipoxygenase homology 2) domain; two SR (scavenger receptor cysteine-rich) domains and a PTX/LamG (pentraxin/laminin-G) domain related to concanavalin A-like module.  

Phenotype
The phenotype analyses indicate a role in the formation of sporozoites in the oocyst (see also Additional information).

Additional information
In another study (Raine, J.D. et al., 2007, PloS Pathogens 3, e30) it has been shown that crossings of the mutant females with wild type males did not rescue the formation of sporozoites. In contrast, crossing of the mutant males with wild type females resulted in wild type production of sporozoites that were infectious to C57BL/6 mice.
The lack of rescue of the ∆pbsr mutant phenotype by crossing of mutant females with wild type males is suggestive of a role of PbSR within a few hours after fertilisation.
The protein is expressed in female gametocytes and in ookinetes. In the ookinetes PbSR is associated with crystalloids, transient organelles that form in developing ookinetes and disappear after ookinete-to-oocyst transition (Carter, V. et al., 2008, Mol. Microbiol. 68, 1560-1569; RMgm-116). Plasmodium crystalloids are cytoplasmic aggregations of closely packed spherical particles 25–35 nm in diameter. In an independent mutant lacking expression of PbSR (RMgm-114) a few oocysts formed sporozoites, which might indicate that PbSR is not essential for sporozoite formation in mosquitoes, but that without functional PbSR sporulation levels are highly reduced. In this mutant no salivary gland sporozoites were detected. Interestingly, sporulation in oocysts of mutants in in vitro cultures of oocysts was comparable to that in wild type oocysts, which might suggest that the function of PbSR is influenced by mosquito factors.

A P. falciparum mutant has been generated that lacks expression of CCp3 (PbSR). This mutant showed 'normal' sporozoite formation (sporulation) within oocysts in Anopheles freeborni. Howver, no hemocoel or salivary gland sporozoites were detected (Pradel G. et al., 2004, J. Exp. Med 199, 1533-1544).

Other mutants
RMgm-114: An independent mutant lacking PbSR
RMgm-115: A mutant containing a mutated form of PbSR
RMgm-116: A mutant expressing a GFP- and mCherry-tagged version of PbSR
RMgm-117: A mutant expressing a GFP- tagged version of PbSR


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1035200
Gene Model P. falciparum ortholog PF3D7_1407000
Gene productLCCL domain-containing protein | scavenger receptor-like protein
Gene product: Alternative namePbSR; P. berghei Scavenger Receptor-like protein; PSLAP; LAP1; CCp3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption The tgdhfr/ts cassette was inserted between nucleotide positions 880 and 2776 of pbsr, thereby removing 1.9 kb of pbsr central coding sequence
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCGGCCGCGAGAATCTATAACTGGGTCAG
Additional information primer 1PbSR/NotI; 5'
Sequence Primer 2GGATCCAGATATGAACCCTTCATGTAACAT
Additional information primer 2PbSR/BamHI; 5'
Sequence Primer 3GGTACCTCTCCTATAAAATAATCAGTTGC
Additional information primer 3PbSR/KpnI; 3'
Sequence Primer 4AAGCTTAGAATCTATAACTGGGTCAG
Additional information primer 4PbSR/HindIII; 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6