RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1249
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0204500; Gene model (P.falciparum): PF3D7_0109100; Gene product: LCCL domain-containing protein (LAP3; LCCL/lectin adhesive-like protein 2; CCp5)
Details mutation: The LCCL domain (amino acids 708–846) of PbLAP3 removed
TaggedGene model (rodent): PBANKA_0204500; Gene model (P.falciparum): PF3D7_0109100; Gene product: LCCL domain-containing protein (LAP3; LCCL/lectin adhesive-like protein 2; CCp5)
Name tag: EGFP
Phenotype Fertilization and ookinete;
Last modified: 3 May 2015, 08:42
  *RMgm-1249
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation, Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25900212
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherS. Saeed; V. Carter; J.T. Dessens
Name Group/DepartmentDepartment of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene & Tropical Medicine
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-1249
Principal namePbLAP3/LCCL-KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot different from wild type
Fertilization and ookineteCultured ookinetes examined by confocal microscopy 24 h post-gametogenesis displayed no apparent differences between PbLAP3/LCCL-KO and PbLAP3/GFP control parasite lines, the majority of ookinetes displaying two fluorescent spots characteristic of the crystalloids.
In contrast, when PbLAP3/LCCL-KO ookinetes were examined at 18 h post-gametogenesis they looked markedly different from PbLAP3/GFP control ookinetes, possessing notably more and generally smaller fluorescent spots. TEM examination of these ookinetes revealed the presence of more and much smaller clusters of subunit vesicles.
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant expresses a GFP-tagged version of  an mutated form of LAP3. The endogenous lap3 gene is tagged with gfp using a construct that integrates via a double cross-over recombination event. In addition, the entire LCCL domain of the endogenous lap3 gene is removed (corresponding to amino acids 708–846 of PbLAP3)

Protein (function)
The lap3 (ccp5) gene is a member of a small conserved gene family, encoding proteins with multiple adhesive domains, for example a Lgl1 (LCCL)-lectin adhesive domain. In P. falciparum the LCCL domain-containing proteins are termed PfCCp's and in P. berghei PbLAP's.
Analysis of the location of a mutant (RMgm-356) expressing a GFP-tagged LAP3 by fluorescence microscopy and immunoelectronmicroscopy shows that the protein is expressed in gametocytes and ookinetes and is associated with crystalloids in the ookinetes. Crystalloids are transient organelles that form in developing ookinetes and disappear after ookinete-to-oocyst transition. Plasmodium crystalloids are cytoplasmic aggregations of closely packed spherical particles 25–35 nm in diameter. In P. berghei, haemozoin-containing vacuoles accumulate around the edges of the crystalloid inclusion bodies.

Phenotype
Phenotype analyses indicate that the LCCL domain of LAP3 is not essential for parasite development (ookinete formation and infectivity). However, evidence is presented that the absence of the LCCL domain affects the formation of crystalloid bodies (see below).

In a mutant lacking expression of LAP3 (1250) crystalloid bodies are absent. This mutants shows a severe defect in formation of sporozoites.

Additional information
When PbLAP3/LCCL-KO ookinetes were examined at 18 h  post-gametogenesis they looked markedly different from PbLAP3/GFP control ookinetes, possessing notably more and generally  smaller fluorescent spots). The same was observed in different clones of the LCCL domain deletion mutant, indicating this  phenotype was not the result of clonal variation. TEM examination  of these ookinetes revealed the presence of more and much smaller  clusters of subunit vesicles. Assessing the number of fluorescent spots/crystalloids in a time course showed a gradual  decrease in their number, indicating that the mini-crystalloids congregate during crystalloid formation. On many occasions  we observed PbLAP3/LCCL-KO ookinetes with several smaller crystalloids in close proximity of each other, seemingly in the process  of merging. A similar process was observed by TEM. Interestingly, in control LAP3/GFP ookinetes there was  also a significant, albeit small, decrease in the mean number of  crystalloids per cell between 18 and 24 h post-gametogenesis, indicating that in wildtype ookinetes, also, crystalloids form by an assembly process. Indeed, young oocysts on the basal side of A. stephensi midguts at 2 days p.i., thee large majority (96%, n = 50) possessed only a single large crystalloid, with the remaining oocysts possessing two closely apposed crystalloids. Thus, crystalloid assembly continues up to development of young oocysts.

Phenotype analyses of mutants lacking expression of different members of the LCCL domain-containing protein family (for example see LAP1/CCp3 RMgm-113, RMgm-114; LAP2/CCp1 RMgm-118, RMgm-121; LAP4/CCp2 RMgm-119; LAP6; CCp4 RMgm-120) indicate a role of several these proteins during oocyst development and sporozoite formation/production.

Other mutants
RMgm-1250: A mutant lacking expression of LAP3


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0204500
Gene Model P. falciparum ortholog PF3D7_0109100
Gene productLCCL domain-containing protein
Gene product: Alternative nameLAP3; LCCL/lectin adhesive-like protein 2; CCp5
Details of the genetic modification
Short description of the mutationThe LCCL domain (amino acids 708–846) of PbLAP3 removed
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationPlasmid pLP-PbLAP3/EFGP (RMgm-356) served as a template for inverse PCR using primers LAP3-LCCLKO-F (5'ACCATCATCCTTTATATTACTCAATACCAAATAGCTATTCA3') and LAP3-LCCLKO-R2 (5'TATAAAGGATGATGGTTCATATATTCATTATCTATTATATTACATGA30) to generate the transfection construct pLP-PbLAP3/LCCL-KO, in which the entire LCCL domain, corresponding to amino acids 708–846 of PbLAP3, has been removed from the PbLAP3 coding sequence.
The plasmid were linearised with HindIII and SacII restriction enzymes to remove the vector backbone.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0204500
Gene Model P. falciparum ortholog PF3D7_0109100
Gene productLCCL domain-containing protein
Gene product: Alternative nameLAP3; LCCL/lectin adhesive-like protein 2; CCp5
Details of the genetic modification
Name of the tagEGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationPlasmid pLP-PbLAP3/EFGP (RMgm-356) served as a template for inverse PCR using primers LAP3-LCCLKO-F (5'ACCATCATCCTTTATATTACTCAATACCAAATAGCTATTCA3') and LAP3-LCCLKO-R2 (5'TATAAAGGATGATGGTTCATATATTCATTATCTATTATATTACATGA30) to generate the transfection construct pLP-PbLAP3/LCCL-KO, in which the entire LCCL domain, corresponding to amino acids 708–846 of PbLAP3, has been removed from the PbLAP3 coding sequence.
The plasmid were linearised with HindIII and SacII restriction enzymes to remove the vector backbone.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6