Summary

RMgm-119
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1319500; Gene model (P.falciparum): PF3D7_1455800; Gene product: LCCL domain-containing protein (LAP4; LCCL/lectin adhesive-like protein 4; CCp2)
Phenotype Oocyst; Sporozoite;
Last modified: 19 February 2009, 21:13
  *RMgm-119
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 17335349
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherJ.D. Raine, R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-119
Principal name∆pblap4
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of oocysts are produced. Sporozoite formation within the oocysts is blocked. The diameters of oocysts were significantly larger than that of wild type on days 14 and 21 of infection. Light microscopy revealed the presence of two distinct populations of oocysts: those that displayed a phenotype reminiscent of immature wild type oocysts (i.e., non-sporulated), and those that appeared vacuolated/degenerate compared to wild type. Transmission electron microscopy analysis of oocysts further confirmed these findings and revealed that oocysts of these parasites possessed an endoplasmic reticulum that was highly vacuolated compared to that of wild type parasites. On day 13 p.i., the nuclear organization of oocysts appeared “immature” as indicated by the presence of few but large nuclei. By comparison, wild type oocysts of the same age had formed sporozoites, each with their own (haploid) nucleus.
SporozoiteNo midgut sporozoites were observed on day 10/11 p.i. By day 18 p.i., reduced numbers (typically 0%–12%) of sporozoites were observed in dissected midguts. The number of sporozoites in salivary gland preparations infections was consistently reduced to <1% of wild type. The expression and targeting of the circumsporozoite protein in midgut sporozoites was indistinguishable from that in wild type.
To test if the observed sporozoites were infectious to mice, infected mosquitoes were allowed to feed on mice on days 21 and 28 p.i. Blood stage parasites were observed in all mice bitten by wild type-infected mosquitoes when screened on day 4/5 post-bite. In contrast, mice bitten by mutant-infected mosquitoes remained uninfected.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of LAP4 (LCCL/lectin adhesive-like protein 4; LCCL domain containing protein CCp2)

Protein (function)
The lap4 (ccp2) gene is a member of a small conserved gene family, encoding proteins with multiple adhesive domains, for example a Lgl1 (LCCL)-lectin adhesive domain. In P. falciparum the LCCL domain-containing proteins are termed PfCCp's.

Phenotype
Phenotype analyses indicate a role during oocyst development and sporozoite formation/production (see also additional information).

Additional information
Crossings of the mutant females with wild type males did not rescue the formation/production of sporozoites. Crossing of the mutant males with wild type females resulted in wild type production of sporozoites that were infectious to C57BL/6 mice. The lack of rescue of the ∆pblap4 mutant phenotype by crossing of mutant females with wild type males is suggestive of a role of LAP4 within a few hours after fertilisation.

Other members of the LAP/CCp family of proteins have been analysed by targeted gene disruption. A number of mutants lacking expression of these proteins show a comparable defect in development of oocysts and formation of sporozoites (RMgm-113, RMgm-114, RMgm-115: LAP1/PbSLAP/PbSR/CCp3; RMgm-118: LAP2/CCp1; RMgm-98: LAP5/FNPA; RMgm-120: LAP6/CCp4).

A P. falciparum mutant has been generated that lacks expression of CCp2 (LAP4). This mutant showed 'normal' sporozoite formation (sporulation) within oocysts in Anopheles freeborni. Howver, no hemocoel or salivary gland sporozoites were detected (Pradel G. et al., 2004, J. Exp. Med 199, 1533-1544).

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1319500
Gene Model P. falciparum ortholog PF3D7_1455800
Gene productLCCL domain-containing protein
Gene product: Alternative nameLAP4; LCCL/lectin adhesive-like protein 4; CCp2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI/BamHI double digest
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Integration of the targeting cassette into the genome leads to replacement of the central 4454bp of the coding region of pblap4 (5151bp)
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGCCCTGTGTACAATTTAGTAGAGTATGTGTATACT
Additional information primer 1DR0008F-pblap4 (ApaI); 5'
Sequence Primer 2AAGCTTCCAGGGGAGTAAGCCC
Additional information primer 2DR0008R-pblap4 (HindIII); 5'
Sequence Primer 3GATATCGCTACGCATAAAGATATTGCTAG
Additional information primer 3DR0009F-pblap4 (EcoRV); 3'
Sequence Primer 4GGATCCCACAAATACAAACAAGTATTAACATATATG
Additional information primer 4DR0009R-pblap4 (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6