RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-674
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1034400; Gene model (P.falciparum): PF3D7_1407800; Gene product: plasmepsin IV (PM4, plasmepsin 4)
DisruptedGene model (rodent): PBANKA_1349100; Gene model (P.falciparum): PF3D7_1335100; Gene product: merozoite surface protein 7 (MSP7)
Phenotype Asexual bloodstage;
Last modified: 23 February 2012, 16:19
  *RMgm-674
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22355558
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/ResearcherR. Spaccapelo; A. Crisanti
Name Group/DepartmentDepartment of Experimental Medicine
Name InstituteUniversity of Perugia
CityPerugia
CountryItaly
top of page
Name of the mutant parasite
RMgm numberRMgm-674
Principal nameΔpm4/Δmsp7 cl4; Δpm4/Δmsp7 cl12
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageIn BALB/c mice the growth rate of Δpm4/Δmsp7 parasites was significantly delayed compared to wild type parasites with a peak of parasitemia at around day 21 that was rapidly cleared from the blood resulting in undetectable parasitemia by microscopic analysis by day 30. Δpm4/Δmsp7 were able to control and completely clear the parasites from the blood of C57BL/6. Notably Δpm4/Dmsp7 parasites induced in C57BL/6 mice a low peak parasitemia that reached a maximum of 10% at day 12 post-infection and by day 25 the infection became undetectable by microscopic analysis. A significant increase of the survival rate was observed in Δpm4/Δmsp7 infected CD1 mice. The majority of the CD1 mice (about 60%) showed a decreased peak of parasitemia, survived the infection and were able to clear the infected red blood cells by day 30 post-injection. The remaining animals died after day 13 post-infection mainly of severe anemia.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Plasmepsin 4 (PM4; plasmepsin IV) and MSP7. The msp7 gene has been disrupted in mutant RMgm-314 which lacks expression of PM4.

Protein (function)
Plasmepsin4 is an aspartic protease of the digestive vacuole and is involved in hemoglobin degradation. P. falciparum has four genes encoding digestive vacuole plasmepsins. Most other Plasmodium species, including P. berghei, have only a single gene encoding a digestive vacuole plasmepsin, plasmepsin4.

In P. falciparum MSP7 (PF13_0197) is a protein of the surface coat of merozoites. The surface coat of the merozoite is composed of a number of proteins, the most abundant of which is a complex of  MSP1, MSP6, and MSP7. Glycosylphosphatidyl inositol (GPI) membrane-anchored MSP1 is processed during maturation of merozoites and erythrocyte invasion. Following invasion, only a C-terminal 19-kDa fragment (MSP119) is retained on the parasite membrane within the newly invaded erythrocyte. The rest of the MSP1 protein is shed as a protein complex comprising four polypeptides of MSP1 and associated with 36- and 22-kDa polypeptides derived from MSP6 and MSP7, respectively.

Rodent malaria parasites have three MSP7-related genes with an adjacent chromosomal location. The exact orthology with the 6 family members of MSP7 (PF13_0197) and the five MSP7-related genes of P. falciparum (MSRP1-5) is not clear. The gene disrupted in this study is in the middle of the cluster of the 3 P. berghei genes: MSRP1 (PBANKA_134920), MSP7 (PBANKA_134910) and MSRP2 (PBANKA_134900)

Phenotype
The mutant shows a a reduced growth rate and a virulence-attenuated phenotype in mice. Blood stages of the mutant are significantly less virulent than wild type P. berghei parasites. Mutant parasites failed to induce experimental cerebral malaria (ECM) in ECM-susceptible mice (i.e. C57Bl/6) and ECM-sensitive and ECM-resistant mice (i.e. BALB/c) were able to clear infections.

The mutant lacking both MSP7 and PM4 expression shows an enhancement of (virulence) attenuation compared to mutants lacking either MSP7 or PM4 (see below).

Additional information

Other mutants
See RMgm-314, RMgm-315, RMgm-316 for independent mutants lacking expression of PM4

See RMgm-224, RMgm-671 and RMgm-673 for independent mutants lacking expression of MSP7

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1034400
Gene Model P. falciparum ortholog PF3D7_1407800
Gene productplasmepsin IV
Gene product: Alternative namePM4, plasmepsin 4
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII, PvuII
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedureThe mutant contains two selectable markers, the tgdhfr and the hdhfr gene. The mutant lacking both msp7 and pm4 has been selected using treatment of mice with WR99210.
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ccgggccctacaaaatattttcataagttggc
Additional information primer 1Sense (ApaI); 5'UTR 945bp
Sequence Primer 2ccatcgatttccattttgaactaattaaag
Additional information primer 2Antisense (ClaI); 5'UTR 945bp
Sequence Primer 3gggaattcttatatatgatatattacacgtac
Additional information primer 3Sense (EcoRI); 3'UTR 813bp
Sequence Primer 4cgggatccatggttttacgatttaaactttc
Additional information primer 4Antisense (BamHI); 3'UTR 813bp
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1349100
Gene Model P. falciparum ortholog PF3D7_1335100
Gene productmerozoite surface protein 7
Gene product: Alternative nameMSP7
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe DNA plasmid pRSpm7-hdhfr, designed to target the msp7 locus in the Δpm4 cl6 background parasites (that already contain the tgdhfr/ts selectable marker used for the deletion of pm4 gene (RMgm-314)), was obtained from plasmid pRSpm7-tgdhfr/ts (RMgm-673) by the exchange of the tgdhfr/ts selectable marker cassette with the human dihydrofolate reductase (hdhfr) selectable marker cassette. The hdhfr cassette was obtained from plasmid pL0008 (MR4) by PstI and EcoRI digestion and cloned into the plasmid pRSpm7-tgdhfr/ts.
Additional remarks selection procedureThe mutant contains two selectable markers, the tgdhfr and the hdhfr gene. The mutant lacking both msp7 and pm4 has been selected using treatment of mice with WR99210.
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren