Summary

RMgm-316
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1034400; Gene model (P.falciparum): PF3D7_1407800; Gene product: plasmepsin IV (PM4, plasmepsin 4)
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_0915000; Gene model (P.falciparum): PF3D7_1133400; Gene product: apical membrane antigen 1
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr-ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Asexual bloodstage;
Last modified: 6 March 2018, 16:58
  *RMgm-316
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20019192
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 1037m1f1mocl1 (RMgm-32)
Other information parent lineP. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter (PubMed: PMID: 20019192). It does not contain a drug-selectable marker and has been selected by FACS sorting based on GFP expression
The mutant parasite was generated by
Name PI/ResearcherR. Spaccapelo; C.J. Janse; J.B. Dame; A. Crisanti
Name Group/DepartmentDepartment of Experimental Medicine
Name InstituteUniversity of Perugia
CityPerugia
CountryItaly
Name of the mutant parasite
RMgm numberRMgm-316
Principal name1092cl4; 1092cl6
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageAsexual blood stages show a slightly reduced growth rate and show a virulence-attenuated phenotype in mice (see 'Additional remarks phenotype').
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Plasmepsin 4 (PM4; plasmepsin IV) and expresses the reporter fusion protein GFP-luciferase under the control of the schizont-specific ama-1 promoter.

Protein (function)
Plasmepsin4 is an aspartic protease of the digestive vacuole and is involved in hemoglobin degradation. P. falciparum has four genes encoding digestive vacuole plasmepsins. Most other Plasmodium species, including P. berghei, have only a single gene encoding a digestive vacuole plasmepsin, plasmepsin4.

Phenotype
Asexual blood stages show a slightly reduced growth rate. A prolonged, less synchronized cell cycle in combination with a delayed and somewhat reduced schizont maturation process results in a slightly reduced multiplication rate in vivo.

The mutant shows a virulence-attenuated phenotype in mice. Blood stages of the mutant are significantly less virulent than wild type P. berghei parasites. Mutant parasites failed to induce experimental cerebral malaria (ECM) in ECM-susceptible mice (i.e. C57Bl/6) and ECM-resistant mice (i.e. BALB/c) were able to clear infections.

In vivo imaging of CD36-mediated sequestration of the schizont stage indicates that CD36-mediated sequestration is comparable to wild type (see also RMgm-32 for the method of in vivo imaging by measuring bioluminescence of the schizonts).

Additional information
After a single infection all convalescent mice were protected against subsequent parasite challenge for at least one year. Real-time in vivo parasite imaging and splenectomy experiments demonstrated that protective immunity acted through antibody-mediated parasite clearance in the spleen. This study shows that a single  gene disruption can generate virulence-attenuated parasites that do not induce cerebral complications and, moreover, are able to stimulate strong protective immunity against subsequent challenge with wild type parasites.

Other mutants
RMgm-314: An independent mutant lacking expression of Plasmepsin4
RMgm-315: An independent mutant lacking expression of Plasmepsin4


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1034400
Gene Model P. falciparum ortholog PF3D7_1407800
Gene productplasmepsin IV
Gene product: Alternative namePM4, plasmepsin 4
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ScaI, NaeI, SapI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Of the 1352bp coding region, the first 443 bp remain intact
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gcatggtaccccttattaaagagattgggaagc
Additional information primer 1Sense (KpnI); 5' 754bp
Sequence Primer 2gcatatcgattttcctaattctgcagtacc
Additional information primer 2Antisense (ClaI); 5' 754bp
Sequence Primer 3gcatgaattccaggacaaattgaaaatgcag
Additional information primer 3Sense (EcoRI); 3' 680bp
Sequence Primer 4gcatccgcggataaatttctttaatcttatggc
Additional information primer 4Antisense (SacII); 3' 680bp
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTT
CTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGC
TCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGA
CGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGC
ATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATA
CGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT
TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT
ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCT
GTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCA
CGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCC
GAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCC
CGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG
GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTA
TGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATC
GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATG
CCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCT
TCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGC
TCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT
CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTAC
ACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCC
TCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT
TTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATG
ACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATC
AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAA
CCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAG
GTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTA
GGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA
CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTG
GAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACG
CTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAG
CGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGC
CACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA
AACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATG
TTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCT
GATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA
GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG
CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAG
CTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
ATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTT
CCGCGGGTATATGGTAAAGAACCTACTAACACAATAAAATATTTAAATAATGTATTTCCT
ATAAATAAATTTACAGATTTATTTTTTAATACAAAAGATATAGATATACCAGAAATAAAT
GATCAGTTTAAAGGTTTTAAATTCTTTATGACATCATTTATAAATCATGGATCATATCCA
CTAACAATAGAATGTGGTGTAACAAATGGTGGAACTAGTTATAAAAGAGCAATTATTTTA
TTGCATGTTCGAACTGATTTAAAAGATAGACCAGTTTCATTTTGTGATTTTCGAAAAGGA
GAATTATATAATTATTTGAATGCTTATACTGAAGGGGATGTATGCATAATAATTTCCAAA
TCAAATACAAGTTTTGGTTTTAGATGCCCAGTAAATACAAAAAAAATGCCAAAAAATTGT
TTTACGCAAGTATATGAAAAAGGGTATCTAAATGACGCCAATAAAATTAATACTAAAAAT
GTTATTAACTATTCATTTGAAAATCCAGAATATGCGCTAGCTGGTTYTAATTATACATTA
ACAAAATCGTATCAATTTGAATGTCATTGTGTAGATAAAGAAACAGAACAAATTGTAAAA
ACGGTTTTAGTCAAATATGTAAATGAAGATGAAATATATGATTATAATGATTTTCCAATG
GTGAATCACAAACCTATTATTGCACATCCAAATAAAACACATCAAGCTTGCATGCCTGCA
GGAATTCGATATCGAATTCCCATGGAACCAAAATAACATATTAATGAATTTTCTTTTATT
GTGAAAATGTTCTTATTTGTTTTAAAAAATCAAAGTAAATTTAATTCCTTTAATTGTGCT
AAATATTGTGTTTGTATAACTATAATGACATTTCCTATGCTTTTTTAATATTATATATAA
TTTTTTGTGTTTTTTCAAAAAAAACGTGTATTTGTTTTTATTTGAGTGTACAATTTGCAT
AGTGAGTTTAAAGTGTTTGAAAATTATTTAATTTATAATTTTCATAAAACGTTTAATCAT
TTATCAAAATTGCGGTTGCAATATAGACAGAAAATATTAACTTAATTTTCATTGTTTTGT
AAAACATTTTCATTATTTTTTTTAACAAAATTAAAGTAAATGAGATGGTAAATTATTTTA
ATTATAACCATTTGTTTAATTTTTTTTATTTTATTACTATTATTTTTTTTCTTTTGTGCT
GCGCAATTAAAAAGAGAATTAAGGGTGCACCAATATATTTAAGCAATCTTTTGCGACACA
CAAGAAAAAATATAACATCAACATATTTAAAATAATGGAAATTTTTTAATAATTTATTCT
ATATATATTTAATATATGTAAAAAAACTAATATTGTAATATAATTAAATAAAACTTGAAA
TTGATATAATATGTATATATATTGCATGTTTAGCTTTAAATAATATTTAAGTATTGATTT
TCTTTACACACAAAAACATTTGCCTTTTTATGTGAGGATTATTGTTTCTTTATTTATATT
GCTATGAATTTATTCTTAGTATAAATTTATTTTTTTTCGGCTTTGAAAATAATTTTATAT
ATATAAAAAGAAAAAATATGGAAAATAAAATTCATAAATCATATTTGACACATTTCAATT
TTTTTTTCTTATTTCACAGCTAGCCATATAATAATATATATGTGTCTATGGGTTCAAATA
GCTTAATTTCAATGTGCGTGATTTTTTTTTATAAAAAAACTAATTTTATGTTTGGTTATG
CATGCAACTGTTATAAAATAAAAATTGTAAAATTTGTTTTTTTGTACACATATTTGTACT
TTTTTTAATGCACATGAAAAAAGAAAGGAAAAAAAAGGGGGAAAAAAAAGGAAAAAAAAA
GGGAAAAAAGGGAAAAAACGTACATCTACGCATTGTTATTTAGCAATAAAATAGAGAACA
AATCTATAAATATATAATGTGTACAACAAATTAATTTAATTTATATTTTTACTGTAATTT
CATAATAATTTTCATTTTTACATTTTAATGTTTTTTTAATTGGAATATAATTCAAAATGA
TTTTGACACATTTTACTTATAGAAGAAGGCTATATAATTATATAAGTGTGTATATATAAG
TATTGTATGGTAATTGTTTTATAAATTAAATTTTTAAAAAACATTATTCTATTTTATAAT
TTGTAAATTAAAAATATTAATAAAATAAAACGATATAAAAGGATCCATGAGTAAAGGAGA
AGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCA
CAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAA
ATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGG
TTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAA
GAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAA
CTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTT
AAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTA
TAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTT
CAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAA
TACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATC
TGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAAC
AGCTGCTGGGATTACACATGGCATGGATGAACTATACAAAGGGATCCTGGCTAGCCAGTC
GACCTGCAGGCATGCAAGCTTGCGGCCGATCCAAATGGAAGACGCCAAAAACATAAAGAA
AGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGC
TATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGT
GAACATCACGTACGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACG
ATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTT
TATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTA
TAATGAACGTGAATTGCTCAACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTC
CAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAAAT
TATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCAC
ATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGA
CAAAACAATTGCACTGATAATGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGC
CCTTCCGCATAGAACTGCCTGCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAA
TCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAAT
GTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGA
AGAAGAGCTGTTTTTACGATCCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACC
AACCCTATTTTCATTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTT
ACACGAAATTGCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAA
ACGCTTCCATCTTCCAGGGATACGACAAGGATATGGGCTCACTGAGACTACATCAGCTAT
TCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTT
TGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGCGA
ATTATGTGTCAGAGGACCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAA
CGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGA
CGAACACTTCTTCATAGTTGACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGT
GGCCCCCGCTGAATTGGAATCGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGT
GGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCA
CGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGC
GAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAA
ACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGC
CGTGTAATTCTAGAAGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATT
TATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGT
AAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACAT
AAAATGGCTAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCA
TATTAAAAATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATT
ATTATTATTATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGT
TGGACTTGATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAA
AAATTAAAAAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTACCGAG
CTCGAATTCTCTTGAGCCCGTTAATGAAATAGATACAATTCATTCATGTTATATACATCT
AGAACATAATCTGAATATGGTTCAAGTTAAATGTCCAAAAATTATAAAAAGTGATGATAT
TTTTGATGGTAATACCATAATAGACACCAAGGTAACATCACGAAGTAGTCAACAAAATAA
TTTTTATTTAGAAAATACAGATGTTGAACCAGAAGAAATAGAGAAATATAAAAATATAGA
ATACATACCAGAAAACGATGAAGTAATGCATCTAGACAAAAAAGAAAAGCTAGATGATAT
ATTACCAGGTGTTATCATATTAGATAAAAATAAAATGTTCAAAGAAAAAGGACATTTCAC
TTTTGTTACTCCATTAATTGTAGAAAAGGTATTAATATTAAAAATATATTGTGATAATAC
TAAAACAATAATTAATAATATGAAAGGGAAAAAAGGTATTACAGTAATAAGGATTTCTCA
AAATACAACAAAAAATAAATTTTATGGATGTGACTTTTCAGGTAATTCTAAAAAAACATT
TTACTATTCCAATGTTTATGATTTAGAAAAAAAAAATGAGTTTTGTGAAATAGAATTAAA
AGAAAATATAGTAGTTAGCTTAAATTGTCCAACTGGTAAAATTAATCCAAAAAATTGTTT
TAGAAATGTATATATAAAAAGTAATATGAATGAACAAACAACCGAAAATATAGAAAATAT
ATTTAACGAAATAAAAGTTATAGATGCAGATTATTTTATAAATAATTCATCAACCTTTTT
GATGATTTCCAAAATTACAAAAAAAGAGTTTGATTTTTATTGTACATGTGAAGATTATAA
AACCAAAAATATAGGAACAATATATATTAAAAATTATGAATATCTAGATTCAAAACCTAA
ATATAAAAATAAACAAATTTCCTATATAGATGTAGTTCCATACCCGCGGGGAAAGGGCG
Restriction sites to linearize plasmid KspI (SacII)
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markerama-1
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0915000
Gene Model P. falciparum ortholog PF3D7_1133400
Gene productapical membrane antigen 1
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr-ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4