Summary

RMgm-673
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1349100; Gene model (P.falciparum): PF3D7_1335100; Gene product: merozoite surface protein 7 (MSP7)
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_0915000; Gene model (P.falciparum): PF3D7_1133400; Gene product: apical membrane antigen 1
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Asexual bloodstage;
Last modified: 23 February 2012, 16:21
  *RMgm-673
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22355558
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 1037m1f1mocl1 (RMgm-32)
Other information parent lineP. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192).
The mutant parasite was generated by
Name PI/ResearcherR. Spaccapelo; A. Crisanti
Name Group/DepartmentDepartment of ExperimentalMedicine
Name InstituteUniversity of Perugia
CityPerugia
CountryItaly
Name of the mutant parasite
RMgm numberRMgm-673
Principal nameΔmsp7+
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageΔmsp7 infected BALB/c mice showed only a mild delay in the parasite growth rate during the initial phase of infection. The mice progressively developed a high parasitemia and died during the third week post infection similarly to wild type-infected mice.
In C57BL/6 mice, Δmsp7 parasites showed a significant reduction of the growth rate up to day 12 post infection and failed to induce signs and symptoms of ECM.
These mice showed a prolonged course of infection with increasing parasitemia and died during the fourth week post infection with a peak parasitemia reaching 70%. All wild type-infected mice died at around day 8 post-infection when the parasitemia was still low (around 20%) developing a typical ECM pathology.
The virulence attenuated phenotype of Δmsp7 parasites varied with the mouse strain used. A substantial fraction of infected Δmsp7 CD1 mice (about 60%) died within 10 days post-infection with signs and symptoms of ECM and with a parasitemia below 15% while the others mice died later of severe anemia.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of MSP7 (merozoite surface protein 7).

Protein (function)
In P. falciparum MSP7 (PF13_0197) is a protein of the surface coat of merozoites. The surface coat of the merozoite is composed of a number of proteins, the most abundant of which is a complex of  MSP1, MSP6, and MSP7. Glycosylphosphatidyl inositol (GPI) membrane-anchored MSP1 is processed during maturation of merozoites and erythrocyte invasion. Following invasion, only a C-terminal 19-kDa fragment (MSP119) is retained on the parasite membrane within the newly invaded erythrocyte. The rest of the MSP1 protein is shed as a protein complex comprising four polypeptides of MSP1 and associated with 36- and 22-kDa polypeptides derived from MSP6 and MSP7, respectively.

Rodent malaria parasites have three MSP7-related genes with an adjacent chromosomal location. The exact orthology with the 6 family members of MSP7 (PF13_0197) and the five MSP7-related genes of P. falciparum (MSRP1-5) is not clear. The gene disrupted in this study is in the middle of the cluster of the 3 P. berghei genes: MSRP1 (PBANKA_134920), MSP7 (PBANKA_134910) and MSRP2 (PBANKA_134900)

Phenotype
Phenotype analyses indicate that MSP7 is not essential for P. berghei blood stage parasite growth. However, parasites lacking expression of MSP7 showed a (minor) growth defect resulting in a lower growth rate in mice during the initial phase of infection. In addition, these parasites showed a reduced growth and virulence phenotype in C57Bl6 mice (see above) and did not induce the typical signs of cerebral malaria in these mice.

Additional information
Using the same plasmid as described here, independent Δmsp7 mutants have been generated in wild type P. berghei ANKA parasites (Δmsp7 cl7;  Δmsp7 cl8).

Other mutants
See RMgm-224 and RMgm-671 for independent P. berghei mutants lacking expression of MSP7


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1349100
Gene Model P. falciparum ortholog PF3D7_1335100
Gene productmerozoite surface protein 7
Gene product: Alternative nameMSP7
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCGGGCCCGCGGGCTAGATTTAATCAGCAATTTGTC
Additional information primer 15'UTR 485 bp PCR fragment sense (ApaI)
Sequence Primer 2CCATCGATTTTGTCTAAATATATGTGTGTGTATG
Additional information primer 25'UTR 485 bp PCR fragment antisense (ClaI)
Sequence Primer 3GGAATTCATTATGTACACAGGAAATACATATAAAAC
Additional information primer 33'UTR 375 bp PCR fragment sense (EcoRI)
Sequence Primer 4CGGGATCCCAATGTTACCGAAGAAAAATACAAAC
Additional information primer 43'UTR 375 bp PCR fragment antisense (BamHI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc
121 gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt gcactctcag tacaatctgc
241 tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc
361 atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact
481 tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt
601 atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca
721 cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc
841 cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta
961 tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt
1081 gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct
1201 tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct
1321 cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc
1441 tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg
1561 accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa
1681 ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
1801 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag
1921 ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga aagcgccacg
2041 cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc
2161 cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg
2281 ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa
2401 gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttag
2521 ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta cgccaagctt
2641 ccgcgggtat atggtaaaga acctactaac acaataaaat atttaaataa tgtatttcct ataaataaat ttacagattt attttttaat acaaaagata tagatatacc agaaataaat
2761 gatcagttta aaggttttaa attctttatg acatcattta taaatcatgg atcatatcca ctaacaatag aatgtggtgt aacaaatggt ggaactagtt ataaaagagc aattatttta
2881 ttgcatgttc gaactgattt aaaagataga ccagtttcat tttgtgattt tcgaaaagga gaattatata attatttgaa tgcttatact gaaggggatg tatgcataat aatttccaaa
3001 tcaaatacaa gttttggttt tagatgccca gtaaatacaa aaaaaatgcc aaaaaattgt tttacgcaag tatatgaaaa agggtatcta aatgacgcca ataaaattaa tactaaaaat
3121 gttattaact attcatttga aaatccagaa tatgcgctag ctggttytaa ttatacatta acaaaatcgt atcaatttga atgtcattgt gtagataaag aaacagaaca aattgtaaaa
3241 acggttttag tcaaatatgt aaatgaagat gaaatatatg attataatga ttttccaatg gtgaatcaca aacctattat tgcacatcca aataaaacac atcaagcttg catgcctgca
3361 ggaattcgat atcgaattcc catggaacca aaataacata ttaatgaatt ttcttttatt gtgaaaatgt tcttatttgt tttaaaaaat caaagtaaat ttaattcctt taattgtgct
3481 aaatattgtg tttgtataac tataatgaca tttcctatgc ttttttaata ttatatataa ttttttgtgt tttttcaaaa aaaacgtgta tttgttttta tttgagtgta caatttgcat
3601 agtgagttta aagtgtttga aaattattta atttataatt ttcataaaac gtttaatcat ttatcaaaat tgcggttgca atatagacag aaaatattaa cttaattttc attgttttgt
3721 aaaacatttt cattattttt tttaacaaaa ttaaagtaaa tgagatggta aattatttta attataacca tttgtttaat tttttttatt ttattactat tatttttttt cttttgtgct
3841 gcgcaattaa aaagagaatt aagggtgcac caatatattt aagcaatctt ttgcgacaca caagaaaaaa tataacatca acatatttaa aataatggaa attttttaat aatttattct
3961 atatatattt aatatatgta aaaaaactaa tattgtaata taattaaata aaacttgaaa ttgatataat atgtatatat attgcatgtt tagctttaaa taatatttaa gtattgattt
4081 tctttacaca caaaaacatt tgccttttta tgtgaggatt attgtttctt tatttatatt gctatgaatt tattcttagt ataaatttat tttttttcgg ctttgaaaat aattttatat
4201 atataaaaag aaaaaatatg gaaaataaaa ttcataaatc atatttgaca catttcaatt tttttttctt atttcacagc tagccatata ataatatata tgtgtctatg ggttcaaata
4321 gcttaatttc aatgtgcgtg attttttttt ataaaaaaac taattttatg tttggttatg catgcaactg ttataaaata aaaattgtaa aatttgtttt tttgtacaca tatttgtact
4441 ttttttaatg cacatgaaaa aagaaaggaa aaaaaagggg gaaaaaaaag gaaaaaaaaa gggaaaaaag ggaaaaaacg tacatctacg cattgttatt tagcaataaa atagagaaca
4561 aatctataaa tatataatgt gtacaacaaa ttaatttaat ttatattttt actgtaattt cataataatt ttcattttta cattttaatg tttttttaat tggaatataa ttcaaaatga
4681 ttttgacaca ttttacttat agaagaaggc tatataatta tataagtgtg tatatataag tattgtatgg taattgtttt ataaattaaa tttttaaaaa acattattct attttataat
4801 ttgtaaatta aaaatattaa taaaataaaa cgatataaaa ggatccatga gtaaaggaga agaacttttc actggagttg tcccaattct tgttgaatta gatggtgatg ttaatgggca
4921 caaattttct gtcagtggag agggtgaagg tgatgcaaca tacggaaaac ttacccttaa atttatttgc actactggaa aactacctgt tccatggcca acacttgtca ctactttcgg
5041 ttatggtgtt caatgctttg cgagataccc agatcatatg aaacagcatg actttttcaa gagtgccatg cccgaaggtt atgtacagga aagaactata tttttcaaag atgacgggaa
5161 ctacaagaca cgtgctgaag tcaagtttga aggtgatacc cttgttaata gaatcgagtt aaaaggtatt gattttaaag aagatggaaa cattcttgga cacaaattgg aatacaacta
5281 taactcacac aatgtataca tcatggcaga caaacaaaag aatggaatca aagttaactt caaaattaga cacaacattg aagatggaag cgttcaacta gcagaccatt atcaacaaaa
5401 tactccaatt ggcgatggcc ctgtcctttt accagacaac cattacctgt ccacacaatc tgccctttcg aaagatccca acgaaaagag agaccacatg gtccttcttg agtttgtaac
5521 agctgctggg attacacatg gcatggatga actatacaaa gggatcctgg ctagccagtc gacctgcagg catgcaagct tgcggccgat ccaaatggaa gacgccaaaa acataaagaa
5641 aggcccggcg ccattctatc cgctggaaga tggaaccgct ggagagcaac tgcataaggc tatgaagaga tacgccctgg ttcctggaac aattgctttt acagatgcac atatcgaggt
5761 gaacatcacg tacgcggaat acttcgaaat gtccgttcgg ttggcagaag ctatgaaacg atatgggctg aatacaaatc acagaatcgt cgtatgcagt gaaaactctc ttcaattctt
5881 tatgccggtg ttgggcgcgt tatttatcgg agttgcagtt gcgcccgcga acgacattta taatgaacgt gaattgctca acagtatgaa catttcgcag cctaccgtag tgtttgtttc
6001 caaaaagggg ttgcaaaaaa ttttgaacgt gcaaaaaaaa ttaccaataa tccagaaaat tattatcatg gattctaaaa cggattacca gggatttcag tcgatgtaca cgttcgtcac
6121 atctcatcta cctcccggtt ttaatgaata cgattttgta ccagagtcct ttgatcgtga caaaacaatt gcactgataa tgaattcctc tggatctact gggttaccta agggtgtggc
6241 ccttccgcat agaactgcct gcgtcagatt ctcgcatgcc agagatccta tttttggcaa tcaaatcatt ccggatactg cgattttaag tgttgttcca ttccatcacg gttttggaat
6361 gtttactaca ctcggatatt tgatatgtgg atttcgagtc gtcttaatgt atagatttga agaagagctg tttttacgat cccttcagga ttacaaaatt caaagtgcgt tgctagtacc
6481 aaccctattt tcattcttcg ccaaaagcac tctgattgac aaatacgatt tatctaattt acacgaaatt gcttctgggg gcgcacctct ttcgaaagaa gtcggggaag cggttgcaaa
6601 acgcttccat cttccaggga tacgacaagg atatgggctc actgagacta catcagctat tctgattaca cccgaggggg atgataaacc gggcgcggtc ggtaaagttg ttccattttt
6721 tgaagcgaag gttgtggatc tggataccgg gaaaacgctg ggcgttaatc agagaggcga attatgtgtc agaggaccta tgattatgtc cggttatgta aacaatccgg aagcgaccaa
6841 cgccttgatt gacaaggatg gatggctaca ttctggagac atagcttact gggacgaaga cgaacacttc ttcatagttg accgcttgaa gtctttaatt aaatacaaag gatatcaggt
6961 ggcccccgct gaattggaat cgatattgtt acaacacccc aacatcttcg acgcgggcgt ggcaggtctt cccgacgatg acgccggtga acttcccgcc gccgttgttg ttttggagca
7081 cggaaagacg atgacggaaa aagagatcgt ggattacgtc gccagtcaag taacaaccgc gaaaaagttg cgcggaggag ttgtgtttgt ggacgaagta ccgaaaggtc ttaccggaaa
7201 actcgacgca agaaaaatca gagagatcct cataaaggcc aagaagggcg gaaagatcgc cgtgtaattc tagaagatcc cgtttttctt acttatatat ttataccaat tgattgtatt
7321 tataactgta aaaatgtgta tgttgtgtgc atattttttt ttgtgcatgc acatgcatgt aaatagctaa aattatgaac attttatttt ttgttcagaa aaaaaaaact ttacacacat
7441 aaaatggcta gtatgaatag ccatatttta tataaattaa atcctatgaa tttatgacca tattaaaaat ttagatattt atggaacata atatgtttga aacaataaga caaaattatt
7561 attattatta ttatttttac tgttataatt atgttgtctc ttcaatgatt cataaatagt tggacttgat ttttaaaatg tttataatat gattagcata gttaaataaa aaaagttgaa
7681 aaattaaaaa aaaacatata aacacaaatg atgttttttc cttcaatttc gggtaccgag ctcgaattct cttgagcccg ttaatgaaat agatacaatt cattcatgtt atatacatct
7801 agaacataat ctgaatatgg ttcaagttaa atgtccaaaa attataaaaa gtgatgatat ttttgatggt aataccataa tagacaccaa ggtaacatca cgaagtagtc aacaaaataa
7921 tttttattta gaaaatacag atgttgaacc agaagaaata gagaaatata aaaatataga atacatacca gaaaacgatg aagtaatgca tctagacaaa aaagaaaagc tagatgatat
8041 attaccaggt gttatcatat tagataaaaa taaaatgttc aaagaaaaag gacatttcac ttttgttact ccattaattg tagaaaaggt attaatatta aaaatatatt gtgataatac
8161 taaaacaata attaataata tgaaagggaa aaaaggtatt acagtaataa ggatttctca aaatacaaca aaaaataaat tttatggatg tgacttttca ggtaattcta aaaaaacatt
8281 ttactattcc aatgtttatg atttagaaaa aaaaaatgag ttttgtgaaa tagaattaaa agaaaatata gtagttagct taaattgtcc aactggtaaa attaatccaa aaaattgttt
8401 tagaaatgta tatataaaaa gtaatatgaa tgaacaaaca accgaaaata tagaaaatat atttaacgaa ataaaagtta tagatgcaga ttattttata aataattcat caaccttttt
8521 gatgatttcc aaaattacaa aaaaagagtt tgatttttat tgtacatgtg aagattataa aaccaaaaat ataggaacaa tatatattaa aaattatgaa tatctagatt caaaacctaa
8641 atataaaaat aaacaaattt cctatataga tgtagttcca tacccgcggg gaaagggcg
Restriction sites to linearize plasmid KspI (SacII)
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markerama-1
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0915000
Gene Model P. falciparum ortholog PF3D7_1133400
Gene productapical membrane antigen 1
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4