Summary

RMgm-644
Malaria parasiteP. yoelii
Genotype
DisruptedGene model (rodent): PY17X_0526200; Gene model (P.falciparum): Not available; Gene product: early transcribed membrane protein family (ETRAMP)
PhenotypeNo phenotype has been described
Last modified: 1 September 2011, 18:24
  *RMgm-644
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21819513
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line17XNL is a non-lethal strain of P. yoelii
The mutant parasite was generated by
Name PI/ResearcherD.C. MacKellar; S.H.I. Kappe
Name Group/DepartmentMolecular and Cellular Biology Program
Name InstituteUniversity of Washington
CitySeattle, Washington
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-644
Principal namePY04799-
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PY04799.

Protein (function)
Early transcribed membrane protein (ETRAMP) family member. Plasmodium conserved family with greater than ten members in P. falciparum. ETRAMPs are abundantly expressed early in the intraerythrocytic cycle and are small (frequently less than 200 aa) integral membrane proteins that are localized within the parasitophorous vacuolar membrane (PVM). All members have signal peptides plus a transmembrane domain. The ETRAMP/SEP proteins of P. yoelii and P. berghei (8-11 genes) show homology to members of the ETRAMP family of proteins of P. falciparum (14 genes) but the orthologous relationship of the different members is not completely resolved.

Phenotype
Phenotype analyses indicate that PY04799 has no essential role during the complete life cycle. Blood stage, mosquito stage and liver stage development of mutant parasites was similar to that of wild type parasites.

Additional information
The ETRAMP/SEP proteins of P. yoelii and P. berghei (8-11 genes) show homology to members of the ETRAMP family of proteins of P. falciparum (14 genes) but the orthologous relationship of the different members is not completely resolved.

P. falciparum P. yoelii P. berghei Syntenic

PFB0120w (ETRAMP2)
PF11_0040 (ETRAMP11.2)

PY00205 PBANKA_050110 (PbSEP3) Py-Pb
PFD1120c (ETRAMP4) PY03869 PBANKA_052420 (PbSEP2) Py-Pb
PF10_0323 (ETRAP10.2) PY07506 PBANKA_051700 Py-Pb
PF10_0164 (ETRAMP10.3) PY00204 (PyUIS4) PBANKA_050120 (UIS4) Py-Pb
PF11_0039 (ETRAMP11.1) PY04799 PBANKA_052480 (PbSEP1)  
PF13_0012 (ETRAMP13) PY03011 (PyUIS3) PBANKA_140080(UIS3) Py-Pb
- Py02667 PBANKA_020160 Py-Pb
- PY03365
PY05433
PY06488
-  
- PY03652 -  

In P. berghei mutants have been generated that lack expression of the 'ortholog' of PY04799, PBANKA_052480 (PbSEP1)(see RMgm-16 and RMgm-18). Phenotype analyses indicate that PbSEP1 has no essential role during the complete P. berghei life cycle.

Other mutants
RMgm-641: A mutant expressing a second, c-myc tagged copy of PY03652 under control of the endogenous promoter
RMgm-640: mutant expressing a c-myc tagged version of PY02667 under control of the endogenous promoter

RMgm-643: A mutant lacking expression of PY03652. The mutant was cloned and the entire life cycle analyzed

RMgm-646: A mutant lacking expression of PY00205. The mutant was analyzed as an enriched population of transgenic parasites containing residual P. yoelii WT
RMgm-647: A mutant lacking expression of PY03869. The mutant was analyzed as an enriched population of transgenic parasites containing residual P. yoelii WT
RMgm-648: A mutant lacking expression of PY03365. The mutant was analyzed as an enriched population of transgenic parasites containing residual P. yoelii WT
RMgm-649: A mutant lacking expression of PY05433. The mutant was analyzed as an enriched population of transgenic parasites containing residual P. yoelii WT
RMgm-650: A mutant lacking expression of PY06488. The mutant was analyzed as an enriched population of transgenic parasites containing residual P. yoelii WT
 
RMgm-642: unsuccessful attempt to disrupt PY02667
RMgm-645: unsuccessful attempt to disrupt PY07506


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PY17X_0526200
Gene Model P. falciparum ortholog Not available
Gene productearly transcribed membrane protein family
Gene product: Alternative nameETRAMP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII, SpeI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCGACCCGATAAAAATTGTTATTATAAAAGACCT
Additional information primer 14799 Rep1F (5')
Sequence Primer 2GCCCAAGCTTGCTTTTGCTAATTTCATTTTTGCACATGT
Additional information primer 24799 Rep2R
Sequence Primer 3GGACTAGTGACAGTAGACCAAAATTTCAAGTATATCCCACA
Additional information primer 34799 Rep3F (3')
Sequence Primer 4TCCCCGCGGCACGGTACTACTTACAATAAACAATAAATCACGGT
Additional information primer 44799 Rep4R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6