RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-645
Malaria parasiteP. yoelii
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PY17X_0518100; Gene model (P.falciparum): Not available; Gene product: early transcribed membrane protein (ETRAMP)
PhenotypeNo phenotype has been described
Last modified: 8 June 2016, 16:38
  *RMgm-645
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification ≥ 5
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21819513
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line17XNL is a non-lethal strain of P. yoelii
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherD.C. MacKellar; S.H.I. Kappe
Name Group/DepartmentMolecular and Cellular Biology Program
Name InstituteUniversity of Washington
CitySeattle, Washington
CountryUSA
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PY17X_0518100
Gene Model P. falciparum ortholog Not available
Gene productearly transcribed membrane protein
Gene product: Alternative nameETRAMP
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII, SpeI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe unsuccessful attempts to disrupt the gene indicates that PY07506 is essential for blood stage growth/multiplication.

Early transcribed membrane protein (ETRAMP) family member. Plasmodium conserved family with greater than ten members in P. falciparum. ETRAMPs are abundantly expressed early in the intraerythrocytic cycle and are small (frequently less than 200 aa) integral membrane proteins that are localized within the parasitophorous vacuolar membrane (PVM). All members have signal peptides plus a transmembrane domain. The ETRAMP/SEP proteins of P. yoelii and P. berghei (8-11 genes) show homology to members of the ETRAMP family of proteins of P. falciparum (14 genes) but the orthologous relationship of the different members is not completely resolved.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCTGGCGAATGCCTATTCTAAAAGAACTAGC
Additional information primer 17506 Rep1F (5')
Sequence Primer 2GCCCAAGCTTCCGCATAGTATTTAAATGTAAGGACATGC
Additional information primer 27506 Rep2R
Sequence Primer 3GGACTAGTGGTTCTGCTTTTAGCTCTACTGGGTCAAGT
Additional information primer 37506 Rep3F (3')
Sequence Primer 4TCCCCGCGGCGGCATGTCATCGACTATTTTAATACATAACC
Additional information primer 47506 Rep4R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren