RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-638
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1420600; Gene model (P.falciparum): PF3D7_0714000; Gene product: histone H2B variant (H2Bv)
Name tag: mCherry
TaggedGene model (rodent): PBANKA_0305600; Gene model (P.falciparum): PF3D7_0208500; Gene product: acyl carrier protein (ACP)
Name tag: GFP
Phenotype Liver stage;
Last modified: 28 August 2011, 20:29
  *RMgm-638
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging, Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21801293
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherR.R. Stanway; V.T. Heussler
Name Group/DepartmentBernhard Nocht Institute for Tropical Medicine
Name InstituteBernhard Nocht Institute for Tropical Medicine
CityHamburg
CountryGermany
top of page
Name of the mutant parasite
RMgm numberRMgm-638
Principal namePbLSmCherryNUCLEO CGFPAPICO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageThe mutant has been used to visualize the apicoplast and mitochondrion during liver stage development.
Additional remarks phenotype

Mutant/mutation
A mutant, PbCGFPapicoLSmCherrynucleo in which the mitochondrial-specific mCherry-tagged citrate synthase (CS) protein is constitutively expressed, but where expression of the nucleus-specific GFP- tagged histone H2B variant protein (H2Bv) is restricted to the liver stage through the use of a liver stage-specific promoter.

Protein (function)
Acyl carrier protein (ACP): an apicoplast-specific protein
Histone H2B variant, putative ((H2Bv): a nuclear-specific protein

Phenotype
The mutant has been used to visualize the apicoplast and mitochondrion during liver stage development.

Additional information

Other mutants
RMgm-635: A The mutant expresssing a apicoplast-specific GFP-tagged acyl carrier protein (ACP) and a mitochondrial-specific mCherry-tagged citrate synthase (CS) protein. Both fusion genes are under control of the constitutive eef1α promoter and inserted into the c/d-ssurra locus.

RMgm-636: A mutant in which the mitochondrial-specific mCherry-tagged citrate synthase (CS) protein is constitutively expressed , but where expression of the apicoplast specific GFP-tagged acyl carrier protein (ACP) is restricted to the liver stage through the use of a liver stage-specific promoter.

RMgm-637: A mutant in which the mitochondrial-specific mCherry-tagged citrate synthase (CS) protein is constitutively expressed, but where expression of the nucleus-specific GFP- tagged histone H2B variant protein (H2Bv) is restricted to the liver stage through the use of a liver stage-specific promoter.

  Tagged: Mutant parasite with a tagged gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1420600
Gene Model P. falciparum ortholog PF3D7_0714000
Gene producthistone H2B variant
Gene product: Alternative nameH2Bv
top of page
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: taggingmCherry targeted to the nucleus by fusion to the targeting sequence of the histone H2B variant protein (H2Bv). Expression under control of the liver stage-specific sequestrin promoter (PBANKA_100300).
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor targeting mCherry to nuclei, the full-length P. berghei histone 2Bv (PBANKA_142060) coding sequence was excised from the plasmid pLSH2Bv-GFP (Nagel et al., submitted; referred to here as pLSGFPNUCLEO) and ligated into the plasmid pLSmCherry, generating the plasmid pLSmCherryNUCLEO.

To create the plasmid for double-fluorescent parasite generation, the expression cassette for constitutive GFP expression, targeted to the apicoplast was amplified by PCR from the plasmid pGFPAPICO (Stanway et al., referred to here as pCGFPAPICO) using the primers CGTAGGTACCAGCTTAATTCTTTTCGAGCTCTTT, binding to the 5’ of the eef1aa promoter and ACTGGGTACCCGAAATTGAAGGAAAAAACATCATTTG,binding to the 3’ of the 3’UTR of the pbdhfr/ts.This cassette was ligated into the plasmid pLSmCherryNUCLEO to generate the plasmid pLSmCherryNUCLEO
CGFPAPICO.

The plasmid allows integration into the c- and dssu-rrna locus by single crossover
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Tagged: Mutant parasite with a tagged gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0305600
Gene Model P. falciparum ortholog PF3D7_0208500
Gene productacyl carrier protein
Gene product: Alternative nameACP
top of page
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: taggingGFP targeted to the apicoplast by fusion to the targeting sequence of the acyl carrier protein (ACP). Expression under control of the constitutive eef1αa promoter (PBANKA_113330).
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor targeting mCherry to nuclei, the full-length P. berghei histone 2Bv (PBANKA_142060) coding sequence was excised from the plasmid pLSH2Bv-GFP (Nagel et al., submitted; referred to here as pLSGFPNUCLEO) and ligated into the plasmid pLSmCherry, generating the plasmid pLSmCherryNUCLEO.

To create the plasmid for double-fluorescent parasite generation, the expression cassette for constitutive GFP expression, targeted to the apicoplast was amplified by PCR from the plasmid pGFPAPICO (Stanway et al., referred to here as pCGFPAPICO) using the primers CGTAGGTACCAGCTTAATTCTTTTCGAGCTCTTT, binding to the 5’ of the eef1aa promoter and ACTGGGTACCCGAAATTGAAGGAAAAAACATCATTTG,binding to the 3’ of the 3’UTR of the pbdhfr/ts.This cassette was ligated into the plasmid pLSmCherryNUCLEO to generate the plasmid pLSmCherryNUCLEO
CGFPAPICO.

The plasmid allows integration into the c- and dssu-rrna locus by single crossover
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren