
Malaria parasiteP. berghei
TaggedGene model (rodent): PBANKA_1420600; Gene model (P.falciparum): PF3D7_0714000; Gene product: histone H2B variant (H2Bv)
Name tag: GFP
TaggedGene model (rodent): PBANKA_0506700; Gene model (P.falciparum): PF3D7_1022500; Gene product: citrate synthase, mitochondrial, putative (CS)
Name tag: mCherry
Phenotype Liver stage;
Last modified: 28 August 2011, 20:31
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging, Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21801293
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherR.R. Stanway; V.T. Heussler
Name Group/DepartmentBernhard Nocht Institute for Tropical Medicine
Name InstituteBernhard Nocht Institute for Tropical Medicine
Name of the mutant parasite
RMgm numberRMgm-637
Principal namePbLSGFPNUCLEO CmCherryMITO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageThe mutant has been used to visualize the nucleus and mitochondrion during liver stage development.
Additional remarks phenotype

A mutant, PbCmCherrymitoLSGFPnucleo in which the mitochondrial-specific mCherry-tagged citrate synthase (CS) protein is constitutively expressed, but where expression of the nucleus-specific GFP- tagged histone H2B variant protein (H2Bv) is restricted to the liver stage through the use of a liver stage-specific promoter.

Protein (function)
Citrate synthase, mitochondrial precursor, putative (CS): a mitochondrial specific protein.
Histone H2B variant, putative ((H2Bv): a nuclear-specific protein

The mutant has been used to visualize the nucleus and mitochondrion during liver stage development.

Additional information
GFP-signals were not only located in the nucleus. GFP-signals were also associated with mitochondria.

Other mutants
RMgm-635: A The mutant expresssing a apicoplast-specific GFP-tagged acyl carrier protein (ACP) and a mitochondrial-specific mCherry-tagged citrate synthase (CS) protein. Both fusion genes are under control of the constitutive eef1α promoter and inserted into the c/d-ssurra locus.

RMgm-636: A mutant in which the mitochondrial-specific mCherry-tagged citrate synthase (CS) protein is constitutively expressed , but where expression of the apicoplast specific GFP-tagged acyl carrier protein (ACP) is restricted to the liver stage through the use of a liver stage-specific promoter.

RMgm-638: A mutant in which the apicoplast-specific GFP-tagged acyl carrier protein (ACP) is constitutively expressed, but where expression of the nucleus-specific mCherry- tagged histone H2B variant protein (H2Bv) is restricted to the liver stage through the use of a liver stage-specific promoter.

  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1420600
Gene Model P. falciparum ortholog PF3D7_0714000
Gene producthistone H2B variant
Gene product: Alternative nameH2Bv
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: taggingGFP targeted to the nucleus by fusion to the targeting sequence of the histone H2B variant protein (H2Bv). Expression under control of the liver stage-specific sequestrin promoter (PBANKA_100300).
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationInitially a mitochondrial targeting sequence was amplified by PCR from the P. berghei citrate synthase (PBANKA_050670) gene using the oligonucleotides 5’- ATATGGATCCATGAAGAAAATAAGAAACATATCACG -3’ and 5’- ATATGGATCCCAAAATGTTCATAATTATAGATTCTTCAC -3’ and was ligated into a pCmCherry plasmid (Graewe et al., 2009), creating the plasmid pCmCherryMITO

To create the plasmid for double-fluorescent parasite generation, the expression cassette for constitutive mCherry expression, targeted to the mitochondrion was amplified by PCR from the plasmid pCmCherryMITO using the primers CGTAGGTACCAGCTTAATTCTTTTCGAGCTCTTT, binding to the 5’ of the eef1aa promoter and ACTGGGTACCCGAAATTGAAGGAAAAAACATCATTTG, binding to the 3’ of the 3’UTR of the pbdhfr/ts.This cassette was ligated into the plasmid pLSH2Bv-GFP (Nagel et al., submitted; referred to here as pLSGFPNUCLEO) to generate the plasmid pLSGFPNUCLEOCmCherryMITO.

The plasmid allows integration into the c- and dssu-rrna locus by single crossover
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0506700
Gene Model P. falciparum ortholog PF3D7_1022500
Gene productcitrate synthase, mitochondrial, putative
Gene product: Alternative nameCS
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: taggingmCherry targeted to the mitochondrion by fusion to the targeting sequence of citrate synthase (CS). Expression under control of the constitutive eef1αa promoter (PBANKA_113330).
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationInitially a mitochondrial targeting sequence was amplified by PCR from the P. berghei citrate synthase (PBANKA_050670) gene using the oligonucleotides 5’- ATATGGATCCATGAAGAAAATAAGAAACATATCACG -3’ and 5’- ATATGGATCCCAAAATGTTCATAATTATAGATTCTTCAC -3’ and was ligated into a pCmCherry plasmid (Graewe et al., 2009), creating the plasmid pCmCherryMITO

To create the plasmid for double-fluorescent parasite generation, the expression cassette for constitutive mCherry expression, targeted to the mitochondrion was amplified by PCR from the plasmid pCmCherryMITO using the primers CGTAGGTACCAGCTTAATTCTTTTCGAGCTCTTT, binding to the 5’ of the eef1aa promoter and ACTGGGTACCCGAAATTGAAGGAAAAAACATCATTTG, binding to the 3’ of the 3’UTR of the pbdhfr/ts.This cassette was ligated into the plasmid pLSH2Bv-GFP (Nagel et al., submitted; referred to here as pLSGFPNUCLEO) to generate the plasmid pLSGFPNUCLEOCmCherryMITO.

The plasmid allows integration into the c- and dssu-rrna locus by single crossover
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6