RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-635
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0305600; Gene model (P.falciparum): PF3D7_0208500; Gene product: acyl carrier protein (ACP)
Name tag: GFP
TaggedGene model (rodent): PBANKA_0506700; Gene model (P.falciparum): PF3D7_1022500; Gene product: citrate synthase, mitochondrial, putative (CS)
Name tag: mCherry
Phenotype Asexual bloodstage; Oocyst;
Last modified: 28 August 2011, 18:52
  *RMgm-635
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging, Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21801293
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherR.R. Stanway; V.T. Heussler
Name Group/DepartmentBernhard Nocht Institute for Tropical Medicine
Name InstituteBernhard Nocht Institute for Tropical Medicine
CityHamburg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-635
Principal namePbCGFPAPICO CmCherryMITO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageThe mutant has been used to visualize the apicoplast and mitochondrion during asexual blood stage development. However, when passaged through mosquitoes to obtain infectious sporozoites, the majority of parasites arrested during the oocyst stage, preventing analysis of organelle development during the liver stage.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystThe mutant has been used to visualize the apicoplast and mitochondrion during asexual blood stage development. However, when passaged through mosquitoes to obtain infectious sporozoites, the majority of parasites arrested during the oocyst stage, preventing analysis of organelle development during the liver stage.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant, PbCGFPAPICOCmCherryMITO, expressses a GFP-tagged acyl carrier protein (ACP) and a mCherry-tagged citrate synthase (CS) protein. Both fusion genes are under control of the constitutive eef1α promoter and inserted into the c/d-ssurra locus.

Protein (function)
Acyl carrier protein (ACP): an apicoplast-specific protein
Citrate synthase, mitochondrial precursor, putative (CS): a mitochondrial specific protein

Phenotype
The mutant has been used to visualize the apicoplast and mitochondrion during asexual blood stage development. However, when passaged through mosquitoes to obtain infectious sporozoites, the majority of parasites arrested during the oocyst stage, preventing analysis of organelle development during the liver stage (see also 'Other mutants').

Additional information

Other mutants
RMgm-636: A mutant in which the mitochondrial-specific mCherry-tagged  citrate synthase (CS) protein is constitutively expressed , but where expression of the apicoplast specific GFP-tagged acyl carrier protein (ACP) is restricted to the liver stage through the use of a liver stage-specific  promoter.

RMgm-637: A mutant in which the mitochondrial-specific mCherry-tagged  citrate synthase (CS) protein is constitutively expressed, but where expression of the nucleus-specific GFP- tagged histone H2B variant protein (H2Bv) is restricted to the liver stage through the use of a liver stage-specific  promoter.

RMgm-638: A mutant in which the apicoplast-specific GFP-tagged  acyl carrier protein (ACP) is constitutively expressed, but where expression of the nucleus-specific mCherry- tagged histone H2B variant protein (H2Bv) is restricted to the liver stage through the use of a liver stage-specific  promoter.


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0305600
Gene Model P. falciparum ortholog PF3D7_0208500
Gene productacyl carrier protein
Gene product: Alternative nameACP
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: taggingGFP targeted to the apicoplast by fusion to the targeting sequence of the acyl carrier protein (ACP). Expression under control of the constitutive eef1αa promoter (PBANKA_113330).
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor generation of parasites constitutively expressing GFP targeted to the apicoplast and mCherry to the mitochondrion, initially a mitochondrial targeting sequence was amplified by PCR from the P. berghei citrate synthase (PBANKA_050670) gene using the oligonucleotides 5’- ATATGGATCCATGAAGAAAATAAGAAACATATCACG -3’ and 5’- ATATGGATCCCAAAATGTTCATAATTATAGATTCTTCAC -3’ and was ligated into a pCmCherry plasmid (Graewe et al., 2009), creating the plasmid pCmCherryMITO. The expression cassette for constitutive mCherry expression, targeted to the mitochondrion was amplified by PCR from the plasmid pCmCherryMITO using the primers CGTAGGTACCAGCTTAATTCTTTTCGAGCTCTTT, binding to the 5’ of the eef1αa promoter and ACTGGGTACCCGAAATTGAAGGAAAAAACATCATTTG, binding to the 3’ of the 3’UTR of the pbdhfr/ts. This cassette was ligated into the plasmid pGFPAPICO ((Stanway et al., 2009), referred to here as pCGFPAPICO), to generate the plasmid pCGFPAPICOCmCherryMITO. The plasmid allows integration into the c- and dssu-rrna locus by single crossover
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0506700
Gene Model P. falciparum ortholog PF3D7_1022500
Gene productcitrate synthase, mitochondrial, putative
Gene product: Alternative nameCS
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: taggingmCherry targeted to the mitochondrion by fusion to the targeting sequence of citrate synthase (CS). Expression under control of the constitutive eef1αa promoter (PBANKA_113330).
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor generation of parasites constitutively expressing GFP targeted to the apicoplast and mCherry to the mitochondrion, initially a mitochondrial targeting sequence was amplified by PCR from the P. berghei citrate synthase (PBANKA_050670) gene using the oligonucleotides 5’- ATATGGATCCATGAAGAAAATAAGAAACATATCACG -3’ and 5’- ATATGGATCCCAAAATGTTCATAATTATAGATTCTTCAC -3’ and was ligated into a pCmCherry plasmid (Graewe et al., 2009), creating the plasmid pCmCherryMITO. The expression cassette for constitutive mCherry expression, targeted to the mitochondrion was amplified by PCR from the plasmid pCmCherryMITO using the primers CGTAGGTACCAGCTTAATTCTTTTCGAGCTCTTT, binding to the 5’ of the eef1αa promoter and ACTGGGTACCCGAAATTGAAGGAAAAAACATCATTTG, binding to the 3’ of the 3’UTR of the pbdhfr/ts. This cassette was ligated into the plasmid pGFPAPICO ((Stanway et al., 2009), referred to here as pCGFPAPICO), to generate the plasmid pCGFPAPICOCmCherryMITO. The plasmid allows integration into the c- and dssu-rrna locus by single crossover
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6