Back to search resultsSummaryRMgm-4675
|
||||||||
*RMgm-4675| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene mutation |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 31428588 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 2.34 |
| Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Coghlan MP, Dessens JT |
| Name Group/Department | Department of Infection Biology |
| Name Institute | London School of Hygiene and Tropical Medicine |
| City | London |
| Country | UK |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-4675 |
| Principal name | IMC1hΔ1 |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Normal numbers of ookinetes are formed. IMC1hΔ1 ookinetes were misshapen, lacking the typical crescent shape and possessing a bulging area in the center similar to the shape of IMC1h-KO ookinetes. IMC1hΔ1 ookinetes displayed only cytoplasmic fluorescence. Aberrant ookinete motility. |
| Oocyst | Reduced oocyst production. |
| Sporozoite | Reduced numbers of salivary gland sporozoites. Sporozoites of parasite line IMC1h11 were misshapen possessing a bulging area, similar to IMC1h null mutant sporozoites. Reduced size of sporozoites. Aberrant sporozoite motility. |
| Liver stage | Sporozoites did not infect mice (after mosquito bite) |
| Additional remarks phenotype | Mutant/mutation Protein (function) Multiple alignment of amino acid sequences of IMC1h orthologs from different Plasmodium species clearly reveals the presence of its single conserved “alveolin” module (domain 1), as well as a conserved carboxy-terminalmodule that is structurally unrelated (domain 2). Sporozoites of parasite line IMC1hΔ1 were misshapen possessing a bulging area, similar to IMC1h null mutant sporozoites (Tremp and Dessens, 2011). Like IMC1hΔ1 ookinetes, these sporozoites displayed only cytoplasmic fluorescence. Other mutants |
Mutated: Mutant parasite with a mutated gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1436600 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1221400 | ||||||||||||||||||||||||||
| Gene product | inner membrane complex protein 1h, putative | ||||||||||||||||||||||||||
| Gene product: Alternative name | IMC1h | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Short description of the mutation | Deletion of domain 1 (“alveolin” module) of IMC1h (amino acids amino acids 397 to 504) | ||||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||||
| Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | To delete domain 1 of IMC1h (amino acids 103 to 306) primers IMC1hdeltadomain1-F (GAGGTTCACAATATTTGAA TAACAATCAAGCACA) and IMC1hdeltadomain1-R (AAATATTGTGAACCTCCATACAAAGTGTGTT) were used to PCR amplify plasmid pLP-IMC1h/GFP (Tremp and Dessens, 2011). Template plasmid was removed after the PCR by DpnI digestion, and the PCR product was circularized by in-fusion, to give plasmid pLP-IMC1h11. This mutation deletes 205 amino acids from the IMC1h::GFP fusion protein. The same approach was used to delete domain 2 (amino acids 397 to 504), using primers IMC1hdeltadomain2-F (ATAATTCGGTTAAAGCTATCCAGAAAAACAT) and MC1hdeltadomain2-R(GCTTTAACCGAATTATTTTGTCTATAATCCATATTTGA) to give plasmid pLP-IMC1h12. This mutation deletes 109 amino acids from the IMC1h::GFP fusion protein | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||