Summary

RMgm-294
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1240700; Gene model (P.falciparum): PF3D7_0525900; Gene product: NIMA related kinase 2 (NEK2)
Transgene
Transgene not Plasmodium: GFP (gfp-mu3)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 28 December 2015, 14:01
  *RMgm-294
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19491095
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherL. Reininger, R. Tewari, O. Billker, C. Doerig
Name Group/DepartmentINSERM U609
Name InstituteWellcome Centre for Molecular Parasitology, Biomedical Research Centre University of Glasgow
CityGlasgow
CountryUK
Name of the mutant parasite
RMgm numberRMgm-294
Principal namepbnek-2- (GFP)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteMale (micro) gametocytes are able to exflagellate as efficiently as wild-type parasites and female (macro)gametocytes emerge normally. Fertilisation occurs, but development is arrested at the 2N zygote stage. The defect is female gamete specific; male gametes are fertile and able to fertilize wild-type female gametes.
OocystFertilisation of female gametes occurs, but development is arrested at the 2N zygote stage and no mature ookinetes are formed. No oocyst are formed in Anopheles stephensi mosquitoes.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of a serine/threonine-protein kinase, Nek2 (a NIMA-related protein kinase). The nek2 gene has been disrupted in mutant RMgm-7, This mutant contains a gfp gene under the control of the eef1a promoter, stably introduced into the genome witthout a drug-selectable marker.

Protein (function)
The NIMA-related protein kinases (Neks) constitute an extended family of eukaryotic mitotic serine/threonine kinases. The best characterized members of the Nek family include NIMA (never in mitosis/Aspergillus), the founding member from the fungus Aspergillus nidulans, and its closest homologue in mammals, Nek2. Initially identified as a kinase essential for mitotic entry in Aspergillus, NIMA has been also shown to participate in nuclear membrane fission. Eleven members of the NIMA kinase family (Nek1-11) have now been identified in various human tissues, and together fulfil a number of cell cycle-related functions in centrosome separation, mitosis, meiosis and checkpoint control. The P. falciparum kinome includes four NIMA-related serine/threonine kinases. Pfnek-1 (PlasmoDB identifier PFL1370w) clusters within the Aspergillus NIMA/human Nek2 branch in phylogenetic trees, while clear orthology to mammalian or yeast Neks could not be assigned for the three other P. falciparum sequences (Pfnek-2, -3 and -4, PlasmoDB identifiers PFE1290w, PFL0080c and MAL7P1.100,respectively).

Phenotype
The phenotype analyses indicate gamete formation and fertilisation are not affected, but development of zygotes is arrested at the 2N zygote stage (see also 'Additional Information').  The analyses suggest that the mutants are unable to properly control pre-meiotic DNA replication.

Additional information
Genetic crosses were used  to determine whether the defect leading to the block in ookinete development was carried by the male or the female gametocytes. Crossing pbnek-2- with pbcdpk4- mutants (RMgm-12), in which male gametocyte exflagellation is abolished and which therefore can produce only female gametes, restored the ookinete development. This indicates that pbnek-2- male gametes are fully functional and can cross-fertilise the pbcdpk4- female gametes. In contrast, crossing the pbnek-2- mutant with a mutant lacking Pbnek-4 (in which female gametocytes carry a defect preventing ookinete development, RMgm-60) did not restore ookinete conversion capacity. Thus, absence of Pbnek-2 causes female gametocytes to be unable to support normal development from zygote to ookinete, similar to the developmental phenotype of  pbnek-4- mutants (RMgm-59, RMgm-60).

In order to investigate in more detail the stage at which the block in ookinete development occurred, the amount of DNA in individual cells was quantified using the DNA-specific fluorescent dye Hoechst 33342. In wild-type parasites, fertilisation is followed by fusion of gamete nuclei and one round of replication, increasing the zygote’s nuclear DNA content to 4C prior to meiosis. Following meiosis four sets of chromosomes are maintained within the ookinetes nucleus, making this stage tetraploid. pbnek-2- parasites appeared to undergo activation and fertilisation like wild-type parasites, but fusion of the two nuclei was impaired in a large proportion of the parasites, and the  DNA content remained at just above 2C, a value consistent with the sum of the two gamete nuclei. In all round cells (i.e. female gametes, zygotes and “failed” ookinetes), the DNA content remained below the 4C value expected in normal ookinetes, indicating that the DNA replication process that precedes meiosis is affected in the mutant parasites.

Analysis of the location of Nek2 in P. falciparum female gametocytes presented in this study indicates that the enzyme localises with what looks like microtubules in female gametocytes. Such a location is consistent with the established role of Neks in the regulation of microtubule dynamics.

See RMgm-59, RMgm-60 for a description of the phenotype of mutants lacking expression of NEK4. In these mutants gamete formation is not affected. Fertilisation occurs, but development is arrested at 2N zygote stage, comparable to the phenotype of the mutant lacking expression of NEK2. Also in the NEK4 mutants the defect is female gamete specific; male gametes are fertile and able to fertilize wild-type female gametes.

The similarity in the phenotypes caused by the loss of Pbnek-2 and Pbnek-4, and the observation that the two enzymes do not trans-phosphorylate or –activate in vitro, suggest that they function in parallel pathways involved in the same cell development process, but are not able to complement for each other.

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565). After transfection with a KO vector a strong PCR signal diagnostic for gene disruption was observed in transfected populations indicating that this gene is not essential for asexual proliferation. Cloning will however be required to validate this interpretation for this


Other mutants
RMgm-288: Another mutant from the same study lacking expression of Nek2.


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1240700
Gene Model P. falciparum ortholog PF3D7_0525900
Gene productNIMA related kinase 2
Gene product: Alternative nameNEK2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/SacII
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe nek2 gene has been disrupted in mutant RMgm-7, This mutant contains a gfp gene under the control of the eef1a promoter, stably introduced into the genome witthout a drug-selectable marker.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGGGTACCTTGGTTCAAAATCATACATAATG
Additional information primer 1forward K0071 (KpnI); 5’ UTR pbnek-2; 776bp
Sequence Primer 2GGGGGGGCCCTGCCATTCTTCAATGACTTAT
Additional information primer 2reverse K0072 (ApaI); 5’ UTR pbnek-2; 776bp
Sequence Primer 3GGGGGGATCCGCCTGATCCACTTCCTAGTA
Additional information primer 3forward K0073 (BamHI); 3’ UTR pbnek-2; 550bp
Sequence Primer 4GGGGCCGCGGATTCAATGGACGGACGC
Additional information primer 4forward K0074 (SacII); 3’ UTR pbnek-2; 550bp
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mu3)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedureThe gfp gene is introduced into the genome using a DNA construct without a drug-selectable marker. This reporter mutant (507cl1; RMgm-7) has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4