SummaryRMgm-59
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 15935755 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | S.M. Khan, C.J. Janse, A.P. Waters |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center |
City | Leiden |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-59 |
Principal name | 545cl1, 545cl2 |
Alternative name | NEK4− |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Gamete formation is not affected. Fertilisation occurs, but development is arrested at 2N zygote stage. The defect is female gamete specific; male gametes are fertile and able to fertilize wild-type female gametes. |
Oocyst | Not tested |
Sporozoite | Not tested |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation Protein (function) The NIMA-related protein kinases (Neks) constitute an extended family of eukaryotic mitotic serine/threonine kinases. The best characterized members of the Nek family include NIMA (never in mitosis/Aspergillus), the founding member from the fungus Aspergillus nidulans, and its closest homologue in mammals, Nek2. Initially identified as a kinase essential for mitotic entry in Aspergillus, NIMA has been also shown to participate in nuclear membrane fission. Eleven members of the NIMA kinase family (Nek1-11) have now been identified in various human tissues, and together fulfil a number of cell cycle-related functions in centrosome separation, mitosis, meiosis and checkpoint control. The P. falciparum kinome includes four NIMA-related serine/threonine kinases. Pfnek-1 (PlasmoDB identifier PFL1370w) clusters within the Aspergillus NIMA/human Nek2 branch in phylogenetic trees, while clear orthology to mammalian or yeast Neks could not be assigned for the three other P. falciparum sequences (Pfnek-2, -3 and -4, PlasmoDB identifiers PFE1290w, PFL0080c and MAL7P1.100,respectively). Phenotype Additional information Other mutants |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0616700 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0719200 | ||||||||||||||||||||||||
Gene product | NIMA related kinase 4 | ||||||||||||||||||||||||
Gene product: Alternative name | serine/threonine protein kinase, Pfnek-4 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map |
![]() | ||||||||||||||||||||||||
Plasmid/construct sequence |
![]() ![]() "ATCTTATTTTCATAATATATGCACCATATTAATTAACAATTCTATTATTAGATCCCCGAT
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | ClaI, XbaI | ||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | In the same study an independent uncloned nek4- mutant was generated using the same sequences (line 563). | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
![]()
| |||||||||||||||||||||||||
top of page |