RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-60
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0616700; Gene model (P.falciparum): PF3D7_0719200; Gene product: NIMA related kinase 4 (serine/threonine protein kinase, Pfnek-4)
Phenotype Fertilization and ookinete;
Last modified: 21 December 2011, 12:40
  *RMgm-60
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 15970588
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/ResearcherL. Reininger, C. Doerig
Name Group/DepartmentINSERM U609
Name InstituteWellcome Centre for Molecular Parasitology, University of Glasgow
CityGlasgow
CountryScotland, UK
top of page
Name of the mutant parasite
RMgm numberRMgm-60
Principal name37.7; 37.9
Alternative namepbnek-4-KO
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteGamete formation is not affected.
Macrogametes become activated but fail to develop into ookinetes.
Fertilisation occurs, but development is arrested at 2N zygote stage. The defect is female gamete specific; male gametes are fertile and able to fertilize wild-type female gametes.
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype


The mutant lacks expression of NEK4 protein.

Protein (function)
NEK4 is a serine/threonine NIMA-related kinase; these kinases are mostly described as being involved in controlling/coordinating signalling processes in mitosis.

The NIMA-related protein kinases (Neks) constitute an extended family of eukaryotic mitotic serine/threonine kinases. The best characterized members of the Nek family include NIMA (never in mitosis/Aspergillus), the founding member from the fungus Aspergillus nidulans, and its closest homologue in mammals, Nek2. Initially identified as a kinase essential for mitotic entry in Aspergillus, NIMA has been also shown to participate in nuclear membrane fission. Eleven members of the NIMA kinase family (Nek1-11) have now been identified in various human tissues, and together fulfil a number of cell cycle-related functions in centrosome separation, mitosis, meiosis and checkpoint control. The P. falciparum kinome includes four NIMA-related serine/threonine kinases. Pfnek-1 (PlasmoDB identifier PFL1370w) clusters within the Aspergillus NIMA/human Nek2 branch in phylogenetic trees, while clear orthology to mammalian or yeast Neks could not be assigned for the three other P. falciparum sequences (Pfnek-2, -3 and -4, PlasmoDB identifiers PFE1290w, PFL0080c and MAL7P1.100,respectively).

Phenotype
Cross-fertilization studies with fertile female gametes from the ∆CDPK4 mutant (RMgm-12; that produce defective males and fertile females) demonstrated that the mutant male gametes are fertile and the defect is exclusively female gamete specific.
In the mutant, fertilsation occurs but parasites arrest during zygote development. This observation indicates that NEK4 is important either just before or during meiosis.

Additional information
Disruption of the P. falciparum ortholog has been succesful (Solyakov et al., 2011, Nat Commun, 2:565) indicating that this gene is not essential for asexual proliferation.
 

Other mutants
An independent P. berghei nek4- mutant (RMgm-59) has been generated that also lacks NEK4 expression and has essentially the same phenotype.

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0616700
Gene Model P. falciparum ortholog PF3D7_0719200
Gene productNIMA related kinase 4
Gene product: Alternative nameserine/threonine protein kinase, Pfnek-4
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption To disrupt pbnek-4, most of the kinase domain (residues 84-247) was replaced with a pyrimethamine-resistant allele of the dhfr/ts gene from T. gondii
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe pbnek-4-KO line has been complemented with an intact copy of the pbnek4 gene, tagged with a carboxy-terminal c-myc epitope tag (insertion vector). Complementation succeeded in restoring ookinete formation, although not to the level of the wild type.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGTACCAGGGATATAGGAAAAGG
Additional information primer 1olLR87KpnI; Primer F 5'
Sequence Primer 2CCCCAAGCTTCTTCACCTTTACAATGC
Additional information primer 2olLR88HindIII; Primer R 5'
Sequence Primer 3CCCCGGATCCATCGAGTTACTGTTCAG
Additional information primer 3olLR89BamHI; Primer F 3'
Sequence Primer 4CCCCGCGGCCGCGTACATGCTGTATATGGGAAC
Additional information primer 4olLR90NotI; Primer R 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
P.berghei model of malaria
Technical design and realization: S. Mededovic and A. van Wigcheren