RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-159
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1306500; Gene model (P.falciparum): PF3D7_1442600; Gene product: TRAP-like protein | sporozoite-specific transmembrane protein S6 (TREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3)
Phenotype Sporozoite; Liver stage;
Last modified: 26 February 2010, 20:21
  *RMgm-159
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19016774
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherM. Steinbuechel; K. Matuschewski
Name Group/DepartmentDepartment of Parasitology
Name InstituteHeidelberg University School of Medicine
CityHeidelberg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-159
Principal nameS6-; TREP- (A1)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of midgut sporozoites are formed. Strong reduction in numbers of salivary gland sporozoites. The deficiency to enter mosquito salivary glands was accompanied by substantial accumulation of viable sporozoites in the mosquito haemocoel.
Strong reduction of gliding motility of oocyst-derived/hemolymph sporozoites. Invasion of hepatoma cells in vitro of purified oocyst-derived/hemolymph sporozoites was strongly reduced. Infection of mice/rats by mosquito bite or by inoculation of purified oocyst-derived/hemolymph sporozoites resulted in blood stage infections.
Liver stageInvasion of hepatoma cells in vitro of purified oocyst-derived/hemolymph sporozoites was strongly reduced. Infection of mice/rats by mosquito bite or by inoculation of purified oocyst-derived/hemolymph sporozoites resulted in blood stage infections, comparable to wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of S6 (sporozoite specific gene 6; TREP, TRAP-related protein; UOS3, upregulated in oocyst sporozoites).

Protein (function)
S6 is a transmembrane protein that possesses a short cytoplasmic tail typical of members of the TRAP/MIC2 family of proteins as well as a single  thrombospondin type I repeat (TSR, TSP) domain. 
S6 has been identified as a sporozoite specific protein 6 (S6) in P. yoelii by analysis of transcripts in sporozoites (Kaiser et al.,  2004, Mol. Microbiol. 51, 1221-32) . The gene encoding S6 is mainly transcribed in midgut (oocyst derived) sporozoites. In salivary gland sporozoites the level of transcription is low. This is in contrast to the two other proteins  belonging to the TRAP/MIC family of proteins, TRAP (PF13_0201) and TLP (PFF0800w), which are mainly expressed in salivary gland sporozoites.

Phenotype
The phenotype analyses indicate a role of S6 in gliding motility of midgut (oocyst derived) sporozoites and invasion of salivary glands. Morover the results of infection of mice and rats by mosquito bite or inoculation of purified sporozoites indicate that TREP is not essential for infectivity to the mammalian host.

Additional information
Other mutants lacking expression of S6 has been generated and analysed (see RMgm-145; RMgm-305). In these studies the protein is named TREP or UOS3. These mutants show a comparable phenotype.

See also GenBank accession number FJ160771 (S6) and FJ167344 (TREP) for the correct sequence of the gene encoding S6/TREP.

Adhesion of sporozoites of this mutant has been analysed in another study (Hegge et al., 2010, FASEB J; PMID: 20159960). Mutant sporozoites showed significant weaker adhesion on glass slides as compared to wild type parasites.

Other mutants

RMgm-145: A mutant lacking expression of TREP/S6/UOS3 (P. berghei)
RMgm-305: A mutant lacking expression of TREP/S6/UOS3 (P. yoelii)
RMgm-306: A mutant expressing a c-myc tagged version of TREP/S6/UOS3 (P. yoelii)


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1306500
Gene Model P. falciparum ortholog PF3D7_1442600
Gene productTRAP-like protein | sporozoite-specific transmembrane protein S6
Gene product: Alternative nameTREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/SacII
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption Two targeting fragments were selected from the non-coding regions of S6. A 1045 bp fragment of the 5' UTR and a 807 bp fragment of the 3' UTR
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TCCCCGCGGGCACTTAATATATGCGATTATGGG
Additional information primer 1S6rep1Ifor (SacII); 5'
Sequence Primer 2CGGGATCCTTTACTCGGTTGTCTATGAATGC
Additional information primer 2S6repIIrev (BamHI); 5'
Sequence Primer 3CCCCAAGCTTTATAGACATGGAACACAAAGAGGATAGC
Additional information primer 3S6rep3for (HindIII); 3'
Sequence Primer 4GGGGTACCTTCTACGAAATCATCTAGTATGCC
Additional information primer 4S6rep4rev (KpnI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6