Summary

RMgm-145
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1306500; Gene model (P.falciparum): PF3D7_1442600; Gene product: TRAP-like protein | sporozoite-specific transmembrane protein S6 (TREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3)
Phenotype Sporozoite; Liver stage;
Last modified: 22 July 2009, 10:50
  *RMgm-145
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19000911
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherA. Combe; T.J. Templeton; R. Menard.
Name Group/DepartmentUnité de Biologie et Génétique du Paludisme
Name InstituteInstitut Pasteur
CityParis
CountryFrance
Name of the mutant parasite
RMgm numberRMgm-145
Principal nameTREP- (A1)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of midgut sporozoites are formed. Strong reduction in numbers of salivary gland sporozoites. Strong reduction of gliding motility of oocyst-derived/hemolymph sporozoites. Infection of mice/rats by mosquito bite or by inoculation of purified oocyst-derived/hemolymph sporozoites resulted in blood stage infections.
Liver stageInfection of mice/rats by mosquito bite or by inoculation of purified oocyst-derived/hemolymph sporozoites resulted in blood stage infections.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of TREP (TRAP-related protein; S6, sporozoite specific gene 6; UOS3, upregulated in oocyst sporozoites).

Protein (function)
TREP is a transmembrane protein that possesses a short cytoplasmic tail typical of members of the TRAP/MIC2 family of proteins as well as a single  thrombospondin type I repeat (TSR, TSP) domain.
TREP has been identified as a sporozoite specific protein 6 (S6) in P. yoelii by analysis of transcripts in sporozoites (Kaiser et al.,  2004, Mol. Microbiol. 51, 1221-32) . The gene encoding TREP is mainly transcribed in midgut (oocyst derived) sporozoites. In salivary gland sporozoites the level of transcription is low. This is in contrast to the two other proteins  belonging to the TRAP/MIC family of proteins, TRAP (PF13_0201) and TLP (PFF0800w), which are mainly expressed in salivary gland sporozoites.

Phenotype
The phenotype analyses indicate a role of TREP in gliding motility of midgut (oocyst derived) sporozoites and invasion of salivary glands. Moreover the results of infection of mice and rats by mosquito bite or inoculation of purified sporozoites indicate that TREP is not essential for infectivity to the mammalian host.

Additional information
The gliding motility of mutant sporozoites was severely impaired. However, unlike sporozoites lacking TRAP (PF13_0201) which remain immotile, a small proportion of the TREP− sporozoites could glide, albeit at slower speeds and for shorter distances.

Other mutants lacking expression of TREP has been generated and analysed (see RMgm-159; RMgm-305). In these studies the protein is named S6 or UOS3. These mutants show a comparable phenotype.

See also GenBank accession number FJ160771 (S6) and FJ167344 (TREP) for the correct sequence of the gene encoding S6/TREP.

Other mutants

RMgm-159: A mutant lacking expression of TREP/S6/UOS3 (P. berghei).
RMgm-305: A mutant lacking expression of TREP/S6/UOS3 (P. yoelii)
RMgm-306: A mutant expressing a c-myc tagged version of TREP/S6/UOS3 (P. yoelii)


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1306500
Gene Model P. falciparum ortholog PF3D7_1442600
Gene productTRAP-like protein | sporozoite-specific transmembrane protein S6
Gene product: Alternative nameTREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI/AscI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption The first PCR product, named «5′TREP», corresponds to the first 606 bp of the open reading frame (ORF) (based on the contig PB000385.03.0) and the second, named «3′TREP», corresponds to a portion of 459 bp of this contig (between position 815 and 1273).
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCGCGGGCCCGGGATGAACATCCATTTTCTAATAAGTGC
Additional information primer 1TREPpBC5-for (ApaI); 5'
Sequence Primer 2GCGCCCCGGGGCAAAGTGATCCATATGTTAAATGATAGC
Additional information primer 2TREPpBC5-rev (SmaI); 5'
Sequence Primer 3GCGCGCGGCCGCCATGCGATGCTGGCTATAAATTTAAACC
Additional information primer 3TREPpBC3-for (NotI); 3'
Sequence Primer 4GCGCGGCGCGCCGGTGATCCTTTTCAATTACCTTGATCAC
Additional information primer 4TREPpBC3-rev (AscI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6