Summary

RMgm-306
Malaria parasiteP. yoelii
Genotype
TaggedGene model (rodent): PY17X_1310300; Gene model (P.falciparum): PF3D7_1442600; Gene product: TRAP-like protein | sporozoite-specific transmembrane protein S6 (TREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3)
Name tag: c-myc
Phenotype Oocyst; Sporozoite;
Last modified: 21 February 2010, 10:31
  *RMgm-306
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18710954
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line17XNL is a non-lethal strain of P. yoelii
The mutant parasite was generated by
Name PI/ResearcherS.A. Mikolajczak; S.H.I. Kappe
Name Group/DepartmentNot applicable
Name InstituteSeattle Biomedical Research Institute
CitySeattle
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-306
Principal nameuos3-myc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystAnti-Myc antibody staining of UOS3-myc oocysts at day 10 postinfection revealed that UOS3 localized to the apical end of oocyst sporozoites that bud from the oocysts.
SporozoiteAnti-Myc antibody staining of UOS3-myc oocysts at day 10 postinfection revealed that UOS3 localized to the apical end of oocyst sporozoites that bud from the oocysts. A similar localization of UOS3 was observed in UOS3-myc hemolymph sporozoites.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses c-myc-tagged version (C-terminal) of UOS3 (upregulated in oocyst sporozoites 3; TREP, TRAP-related protein; S6, sporozoite specific gene 6 )

Protein (function)
UOS3 is a transmembrane protein that possesses a short cytoplasmic tail typical of members of the TRAP/MIC2 family of proteins as well as a single  thrombospondin type I repeat (TSR, TSP) domain. UOS3 was detected in a genome-wide expression screen with the rodent malaria model P. yoelii. It was found that at transcription of at least 47 genes is specifically upregulated before salivary gland infection (UOS genes: upregulated in oocyst sporozoites) but downregulated after salivary gland infection. UOS3 exhibited significant differential expression in sporozoites. UOS3 transcription is high in oocyst-derived sporozoites but low in salivary gland sporozoites. Phenotype analyses of mutants lacking expression of UOS3/TREP/S6 (RMgm-145, RMgm-159, RMgm-305) indicate a role of this protein in invasion of salivary glands. UOS3/TREP/S6 is not essential for infectivity to the mammalian host.

Phenotype
Phenotype analyses indicate that UOS3 is expressed in oocyst-derived sporozoites. UOS3 was found to be located at the apical end of sporozoites. Simultaneous staining of UOS3myc and TRAP, a known micronemal protein, showed only a partial overlap in localization.  The localization and the punctuate appearance of UOS3myc distribution suggests that the protein is a part of the apical invasive/secretory organelles.

Additional information

Other mutants
RMgm-145: A mutant lacking expression of TREP/S6/UOS3 (P. berghei)
RMgm-159: A mutant lacking expression of TREP/S6/UOS3 (P. berghei)
RMgm-305: A mutant lacking expression of TREP/S6/UOS3 (P. Yoelii)


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PY17X_1310300
Gene Model P. falciparum ortholog PF3D7_1442600
Gene productTRAP-like protein | sporozoite-specific transmembrane protein S6
Gene product: Alternative nameTREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3
Details of the genetic modification
Name of the tagc-myc
Details of taggingC-terminal
Additional remarks: taggingQuadruple Myc tag sequence (4x myc). For fluorescent detection, the secondary antibodies Alexa Fluor 488 and Alexa Fluor 594 were used
Commercial source of tag-antibodiesAntibody A-14 (Santa Cruz Biotechnology). Secondary antibodies Alexa Fluor 488 and Alexa Fluor 594 (
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid BsaBI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor the generation of UOS3 tagged with the Myc epitope (UOS3-myc), a quadruple (4×) Myc tag sequence was introduced into the b3D.DT∧H.∧D vector (catalog no. MRA-80 in the MR4-Malaria Research and Reference Reagent Resource Center; http://www.malaria.mr4.org) followed by the 3′ untranslated region of the P. berghei dihydrofolate reductase gene. The C-terminal fragment of uos3 (without the stop codon) was cloned into the plasmid in frame and adjacent to the Myc tag. Insertion resulted in expression of a UOS3myc chimeric protein under the control of the endogenous UOS3 5′ upstream DNA region
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCCCGCGGTACACATGCAAAATAAAGCGGATA
Additional information primer 1C-terminal fragment of uos3 (SacII)
Sequence Primer 2GGACTAGTTGACCAATCATCATTAACGTAACT
Additional information primer 2C-terminal fragment of uos3 (SpeI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6