RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-158
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: AGFP (Azami GFP)
Promoter: Gene model: PBANKA_1212600; Gene model (P.falciparum): PF3D7_1014200; Gene product: male gamete fusion factor HAP2, putative (HAP2; GCS1, Generative Cell Specific 1)
3'UTR: Gene model: PBANKA_1212600; Gene product: male gamete fusion factor HAP2 (HAP2; GCS1, Generative Cell Specific 1)
Insertion locus: Gene model: PBANKA_1212600; Gene product: male gamete fusion factor HAP2 (HAP2; GCS1, Generative Cell Specific 1)
Phenotype Fertilization and ookinete;
Last modified: 28 January 2011, 14:04
  *RMgm-158
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18403203
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherM. Hirai; H. Matsuoka
Name Group/DepartmentDivision of Medical Zoology, Department of Infection and Immunity
Name InstituteJichi Medical University School of Medicine
CityShimotsuke City
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-158
Principal namegcs1prom::agfp
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNo GFP expression in asexual blood stages and female gametocytes and gametes. Only male gametocytes and male gametes are GFP-positive.
No GFP expression in ookinetes.
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses GFP (Azami GFP) under the control of the promoter region of gcs1 (Generative Cell Specific 1; HAP2).

Protein (function)
In Arabidopsis the male-specific sterility protein HAP2 has been identified by a genetic screen (HAP mutants: containing haploid-disrupting (hapless) mutations; Johnson M.A. et al., 2004, Genetics 168, 971-82) . A HAP2 family member called GCS1 (for generative cell-specific) was subsequently identified in a screen for lily genes whose transcripts were up-regulated in sperm (generative cells) . GCS1/HAP2 is conserved and members were found in rice, Chlamydomonas, a red alga, a slime mold, Plasmodium falciparum, and Leishmania major. Phenotype analyses of mutants lacking expression of GCS1/HAP2  (RMgm-155, RMgm-156) indicate a role of GCS1/HAP2 in fertilisation. Female gametes are fertile, whereas male gametes are sterile. Male gametes are able to attach to female gametes and form tight prefusion membrane attachments but the membranes of the gametes do not merge or fuse.

Phenotype
The phenotype analyses indicate specific expression of GCS1 in male gametocytes and male gametes. See also mutants RMgm-157 and RMgm-167 which expresses GFP-tagged versions of GCS1/HAP2.
Phenotype analyses of mutants lacking expression of GCS1/HAP2  (RMgm-155, RMgm-156) indicate a role of GCS1/HAP2 in fertilisation. Female gametes are fertile, whereas male gametes are sterile. Male gametes are able to attach to female gametes and form tight prefusion membrane attachments but the membranes of the gametes do not merge or fuse.

Additional information
GenBank accession no. XM_671808.

Other mutants
RMgm-155: An independent mutant lacking expression of HAP2/GCS1.
RMgm-156: A mutant lacking expression of HAP2/GCS1.
RMgm-157: A mutant expressing a GFP-tagged form of HAP2/GCS1
RMgm-167: A mutant expressing a GFP-tagged form of HAP2/GCS1
RMgm-605: A mutant expressing a mutated form of HAP2/GCS1 lacking the HAP2-GCS1 (HG) domain
RMgm-606: A mutant expressing a mutated form of HAP2/GCS1 lacking the entire C-terminal region downstream from the TM domain
RMgm-607: A mutant expressing a mutated form of HAP2/GCS1 lacking the TM domain and the entire C-terminal region downstream from the TM domain


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameAGFP (Azami GFP)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid BclI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe Azami Green Fluorescent Protein (AGFP) cDNA was amplified from CoralHue monomeric Azami-Green (pmAG1-S1) plasmid (MBL). The gcs1-agfp gene is under the regulation of the endogenous gcs1 gene promoter.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1212600
Gene Model P. falciparum ortholog PF3D7_1014200
Gene productmale gamete fusion factor HAP2, putative
Gene product: Alternative nameHAP2; GCS1, Generative Cell Specific 1
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1GGGGACAACTTTGTATAGAAAAGTTGGATAATGACGATGATGAAG
Additional information primer 1PbGCS1-F9attB4F
Sequence Primer 2GGGGACTGCTTTTTTGTACAAACTTGTTTTTCTAAATGAAATATTAAAG
Additional information primer 2PbGCS1-R5attB1R
3'-UTR
Gene Model of Parasite PBANKA_1212600
Gene productmale gamete fusion factor HAP2
Gene product: Alternative nameHAP2; GCS1, Generative Cell Specific 1
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1GGGGACAGCTTTCTTGTACAAAGTGGAATTACATGGAATAGTATTTGCAAATTTGTG
Additional information primer 1PbGCS1-3UTRFattB2
Sequence Primer 2GGGGACAACTTTGTATAATAAAGTTGATACGAAATATTCACAATATATAATTCTGC
Additional information primer 2PbGCS1-3UTRRattB3R
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite PBANKA_1212600
Gene productmale gamete fusion factor HAP2
Gene product: Alternative nameHAP2; GCS1, Generative Cell Specific 1
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGACAACTTTGTATAGAAAAGTTGGATAATGACGATGATGAAG
Additional information primer 1PbGCS1-F9attB4F
Sequence Primer 2GGGGACTGCTTTTTTGTACAAACTTGTTTTTCTAAATGAAATATTAAAG
Additional information primer 2PbGCS1-R5attB1R
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4