RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-156

Malaria parasite	P. berghei
Genotype
Disrupted	Gene model (rodent): PBANKA_1212600; Gene model (P.falciparum): PF3D7_1014200; Gene product: male gamete fusion factor HAP2, putative (HAP2; GCS1, Generative Cell Specific 1)
Phenotype	Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;

Last modified: 28 January 2011, 14:07

*RMgm-156

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene disruption
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 18403203
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	P. berghei ANKA 2.34
Other information parent line	P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/Researcher	M. Hirai; H. Matsuoka
Name Group/Department	Division of Medical Zoology, Department of Infection and Immunity
Name Institute	Jichi Medical University School of Medicine
City	Shimotsuke City
Country	Japan
top of page
Name of the mutant parasite
RMgm number	RMgm-156
Principal name	PbGCS1(-) (clone 1-3; 2-5; 3-6)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Normal numbers of male and female gametocytes are produced. Gamete formation was comparable to that of wild type parasites, as determined by light microscopy of exflagellation (male gamete formation) and escape of females from the host erythrocyte. Male gametes are sterile as shown by the lack of fertilisation when the mutant males are crossed with fertile female gametes. Mutant female gametes are fertile as shown by cross-fertilisation with wild type male gametes.
Fertilization and ookinete	Gamete formation was comparable to that of wild type parasites, as determined by light microscopy of exflagellation (male gamete formation) and escape of females from the host erythrocyte. Male gametes are sterile as shown by the lack of fertilisation when the mutant males are crossed with fertile female gametes. Mutant female gametes are fertile as shown by cross-fertilisation with wild type male gametes. Mutant males gametes showed flagella motility and adhesion to surrounding erythrocytes, forming exfagellating centers comparable to wild type. However, no successful entering of flagella into female gametes was observed.
Oocyst	No ookinete and oocyst formation (see phenotype 'Fertilization and ookinete').
Sporozoite	No sporozoite formation (see phenotype 'Fertilization and ookinete' and 'Oocyst').
Liver stage	Not different from wild type
Additional remarks phenotype	Mutant/mutation The mutant lacks expression of GCS1 (Generative Cell Specific 1; HAP2) Protein (function) In Arabidopsis the male-specific sterility protein HAP2 has been identified by a genetic screen (HAP mutants: containing haploid-disrupting (hapless) mutations; Johnson M.A. et al., 2004, Genetics 168, 971-82) . A HAP2 family member called GCS1 (for generative cell-specific) was subsequently identified in a screen for lily genes whose transcripts were up-regulated in sperm (generative cells) . GCS1/HAP2 is conserved and members were found in rice, Chlamydomonas, a red alga, a slime mold, Plasmodium falciparum, and Leishmania major. Phenotype The phenotype analyses indicate a role of GCS1/HAP2 in fertilisation. Female gametes are fertile, whereas male gametes are sterile. Male gametes are able to attach to female gametes but fusion of the gametes does not occur Additional information GenBank accession no. XM_671808. Other mutants RMgm-155: An independent mutant lacking expression of HAP2/GCS1. RMgm-157: A mutant expressing a GFP-tagged form of HAP2/GCS1 RMgm-167: A mutant expressing a GFP-tagged form of HAP2/GCS1 RMgm-158: A mutant expressing GFP under the control of the hap2/gcs1 promoter RMgm-605: A mutant expressing a mutated form of HAP2/GCS1 lacking the HAP2-GCS1 (HG) domain RMgm-606: A mutant expressing a mutated form of HAP2/GCS1 lacking the entire C-terminal region downstream from the TM domain RMgm-607: A mutant expressing a mutated form of HAP2/GCS1 lacking the TM domain and the entire C-terminal region downstream from the TM domain

Disrupted: Mutant parasite with a disrupted gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1212600

Gene Model P. falciparum ortholog

PF3D7_1014200

Gene product

male gamete fusion factor HAP2, putative

Gene product: Alternative name

HAP2; GCS1, Generative Cell Specific 1

top of page

Details of the genetic modification

Inducable system used

Additional remarks inducable system

Type of plasmid/construct used

Plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Partial or complete disruption of the gene

Partial

Additional remarks partial/complete disruption

Part of the 5' and 3' pbgcs1 coding region was used as targetting sequences.

Selectable marker used to select the mutant parasite

tgdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	AAGCTTAGTGAGATTAAAGGTGATGAG
Additional information primer 1	GCS1F1 (HindIII); 5'
Sequence Primer 2	AAGCTTGATGATACATCATTGTAATA
Additional information primer 2	GCS1R1 (HindIII); 5'
Sequence Primer 3	GAATTCTGATGAATATGTATGTAAATG
Additional information primer 3	GCS1F2 (EcoRI); 3'
Sequence Primer 4	GGATCCTGACGGAGATGTATCTGC
Additional information primer 4	GCS1R2 (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page