Back to search resultsSummaryRMgm-1115
|
||||||||
*RMgm-1115| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Other |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25156724 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei NK65 |
| Name parent line/clone | Not applicable |
| Other information parent line | This NK65 line was obtained from Dr. P. E. van den Steen (Leuven) and originated from the NK65 strain available from the Edinburg collection. The GIMO mother line GIMOPbNK65 (1995cl1, cl2) described here may have slightly increased virulence features in mice compared to the original 'NK65 Edinburg' parent line (see below). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | J. Lin; C.J. Janse; S.M. Khan |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1115 |
| Principal name | GIMOPbNK65 |
| Alternative name | 1995cl1; 1995cl2 |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation This line is named GIMO mother line (gene insertion/marker out): GIMOPbNK65 (line 1596cl1). The GIMO mother line shows a normal development during blood stage development although blood stage development has not been characterized in great detail. This line can be used as a reference line for introduction of transgenes. Several transgenic lines have been generated in this GIMO mother line. Analysis of blood infections of these transgenic lines has provided some evidence that these parasites induce infections in mice with slightly increased virulence features (higher parasitemia; earlier death) compared to the original 'NK65 Edinburg' parent line (unpublished observations). The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice. |
Other: Mutant parasite with another genetic modification| top of page | |
| Details of the target gene | |
| Gene Model of Rodent Parasite | PBANKA_0306000 |
| Gene Model P. falciparum ortholog | PF3D7_0208900 |
| Gene product | 6-cysteine protein |
| Gene product: Alternative name | P230p; |
| top of page | |
| Description | |
| Short description of the modification | The GIMO-mutant contains the hdhfr::yfcu positive-negative selection marker in the silent 230p locus |
| Description | The mutant expresses a fusion of a drug resistance gene and a drug sensitivity gene, the so called postive-negative selectable marker (SM), constitutively expressed by the P. berghei eef1α promoter. Specifically, the mutant contains a fusion gene of hdhfr (human dihydrofolate reductase; positive SM) and yfcu (yeast cytosine deaminase and uridyl phosphoribosyl transferase; negative SM) stably integrated into the 230p locus (PBANKA_030600) through double cross-over recombination. The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice. To generate the GIMO mother line in P. berghei, a DNA-construct pL1603 was generated for integration into the 230p gene (PBANKA_030600) by cloning the 5' and 3' regions of 230p as previously described. The targeting sequences were amplified from genomic DNA using primer sets 5585/5586 (pb230p 5’- targeting sequence, F: CTTGGTGACGAAGCTTGTATATGGTAAAGAACCTACTAACAC;pb230p 5’- targeting sequence, R: CTTGGTGACGCCGCGGAGGATGTGTTTTATTTGGATGTG ) and 5587/5588 (pb230p 3’- targeting sequence, F: CCGGGGTACCAATTCTCTTGAGCCCGTTAATG; pb230p 3’- targeting sequence, R: CCGGGAATTCGTATGGAACTACATCTATATAGG) and cloned into the restriction sites of HindIII/KspI and Asp718I/EcoRI of the standard cloning vector pL0034 (MRA-849, www.mr4.org), which contains the hdhfr::yfcu selectable marker under the control of the eef1α promoter. The hdhfr::yfcu marker is a fusion gene of the positive selection marker human dihydrofolate reductase and the negative selection marker which is a fusion gene of yeast cytosine deaminase and uridyl phosphoribosyl transferase. Prior to transfection the DNA-construct pL1603 was linearized with HindIII and EcoRI. |
| top of page | |