Back to search resultsSummaryRMgm-687
|
||||||||
*RMgm-687| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Other |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 22216235 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | J. Lin; C.J. Janse; S.M. Khan |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-687 |
| Principal name | GIMOPbANKA |
| Alternative name | 1596cl1 |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Not different from wild type |
| Oocyst | Not different from wild type |
| Sporozoite | Not different from wild type |
| Liver stage | Not different from wild type |
| Additional remarks phenotype | Mutant/mutation This line is named GIMO mother line (gene insertion/marker out): GIMOPbANKA (line 1596cl1). The GIMO mother line shows a normal development during the complete life cycle, including development in the mosquito and in the liver. This line can therefore be used as a reference line for introduction of transgenes. The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice. |
Other: Mutant parasite with another genetic modification| top of page | |
| Details of the target gene | |
| Gene Model of Rodent Parasite | PBANKA_0306000 |
| Gene Model P. falciparum ortholog | PF3D7_0208900 |
| Gene product | 6-cysteine protein |
| Gene product: Alternative name | P230p; |
| top of page | |
| Description | |
| Short description of the modification | The GIMO-mutant contains the hdhfr::yfcu positive-negative selection marker in the silent 230p locus |
| Description | The mutant expresses a fusion of a drug resistance gene and a drug sensitivity gene, the so called postive-negative selectable marker (SM), constitutively expressed by the P. berghei eef1α promoter. Specifically, the mutant contains a fusion gene of hdhfr (human dihydrofolate reductase; positive SM) and yfcu (yeast cytosine deaminase and uridyl phosphoribosyl transferase; negative SM) stably integrated into the 230p locus (PBANKA_030600) through double cross-over recombination. The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice. To generate the GIMO mother line in P. berghei, a DNA-construct pL1603 was generated for integration into the 230p gene (PBANKA_030600) by cloning the 5' and 3' regions of 230p as previously described. The targeting sequences were amplified from genomic DNA using primer sets 5585/5586 (pb230p 5’- targeting sequence, F: CTTGGTGACGAAGCTTGTATATGGTAAAGAACCTACTAACAC;pb230p 5’- targeting sequence, R: CTTGGTGACGCCGCGGAGGATGTGTTTTATTTGGATGTG ) and 5587/5588 (pb230p 3’- targeting sequence, F: CCGGGGTACCAATTCTCTTGAGCCCGTTAATG; pb230p 3’- targeting sequence, R: CCGGGAATTCGTATGGAACTACATCTATATAGG) and cloned into the restriction sites of HindIII/KspI and Asp718I/EcoRI of the standard cloning vector pL0034 (MRA-849, www.mr4.org), which contains the hdhfr::yfcu selectable marker under the control of the eef1α promoter. The hdhfr::yfcu marker is a fusion gene of the positive selection marker human dihydrofolate reductase and the negative selection marker which is a fusion gene of yeast cytosine deaminase and uridyl phosphoribosyl transferase. Prior to transfection the DNA-construct pL1603 was linearized with HindIII and EcoRI. |
| top of page | |