Summary

RMgm-687
Malaria parasiteP. berghei
Genotype
Other modificationGene model (rodent): PBANKA_0306000; Gene model (P.falciparum): PF3D7_0208900; Gene product: 6-cysteine protein (P230p;)
Details modification: The GIMO-mutant contains the hdhfr::yfcu positive-negative selection marker in the silent 230p locus
PhenotypeNo phenotype has been described
Last modified: 5 January 2012, 10:08
  *RMgm-687
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Other
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22216235
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherJ. Lin; C.J. Janse; S.M. Khan
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-687
Principal nameGIMOPbANKA
Alternative name1596cl1
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant expresses a fusion of a drug resistance gene and a drug sensitivity gene, the so called postive-negative selectable marker (SM), constitutively expressed by the P. berghei eef1α promoter. Specifically, the mutant contains a fusion gene of hdhfr (human dihydrofolate reductase; positive SM) and yfcu (yeast cytosine deaminase and uridyl phosphoribosyl transferase; negative SM) stably integrated into the 230p locus (PBANKA_030600) through double cross-over recombination.

This line is named GIMO mother line (gene insertion/marker out): GIMOPbANKA (line 1596cl1).

The GIMO mother line shows a normal development during the complete life cycle, including development in the mosquito and in the liver. This line can therefore be used as a reference line for introduction of transgenes.

The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice.

The use of this line greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals.

Other mutants
RMgm-688: A GIMO reference motherline of P. yoelii (17XNL)


  Other: Mutant parasite with another genetic modification
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0306000
Gene Model P. falciparum ortholog PF3D7_0208900
Gene product6-cysteine protein
Gene product: Alternative nameP230p;
Description
Short description of the modificationThe GIMO-mutant contains the hdhfr::yfcu positive-negative selection marker in the silent 230p locus
DescriptionThe mutant expresses a fusion of a drug resistance gene and a drug sensitivity gene, the so called postive-negative selectable marker (SM), constitutively expressed by the P. berghei eef1α promoter. Specifically, the mutant contains a fusion gene of hdhfr (human dihydrofolate reductase; positive SM) and yfcu (yeast cytosine deaminase and uridyl phosphoribosyl transferase; negative SM) stably integrated into the 230p locus (PBANKA_030600) through double cross-over recombination.

The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice.

To generate the GIMO mother line in P. berghei, a DNA-construct pL1603 was generated for integration into the 230p gene (PBANKA_030600) by cloning the 5' and 3' regions of 230p as previously described. The targeting sequences were amplified from genomic DNA using primer sets 5585/5586 (pb230p 5’- targeting sequence, F: CTTGGTGACGAAGCTTGTATATGGTAAAGAACCTACTAACAC;pb230p 5’- targeting sequence, R: CTTGGTGACGCCGCGGAGGATGTGTTTTATTTGGATGTG ) and 5587/5588 (pb230p 3’- targeting sequence, F: CCGGGGTACCAATTCTCTTGAGCCCGTTAATG; pb230p 3’- targeting sequence, R: CCGGGAATTCGTATGGAACTACATCTATATAGG) and cloned into the restriction sites of HindIII/KspI and Asp718I/EcoRI of the standard cloning vector pL0034 (MRA-849, www.mr4.org), which contains the hdhfr::yfcu selectable marker under the control of the eef1α promoter. The hdhfr::yfcu marker is a fusion gene of the positive selection marker human dihydrofolate reductase and the negative selection marker which is a fusion gene of yeast cytosine deaminase and uridyl phosphoribosyl transferase. Prior to transfection the DNA-construct pL1603 was linearized with HindIII and EcoRI.