RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-688
Malaria parasiteP. yoelii
Genotype
Other modificationGene model (rodent): PY17X_0306600; Gene model (P.falciparum): PF3D7_0208900; Gene product: 6-cysteine protein (P230p; 230p)
Details modification: The GIMO-mutant contains the hdhfr::yfcu positive-negative selection marker in the silent 230p locus
PhenotypeNo phenotype has been described
Last modified: 13 March 2013, 17:16
  *RMgm-688
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Other
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22216235
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone clone 1.1
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherJ. Lin; C.J. Janse; S.M. Khan
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-688
Principal nameGIMOPy17X
Alternative name1923cl1
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant expresses a fusion of a drug resistance gene and a drug sensitivity gene, the so called positive-negative selectable marker (SM), constitutively expressed by the P. berghei eef1α promoter. Specifically, the mutant contains a fusion gene of hdhfr (human dihydrofolate reductase; positive SM) and yfcu (yeast cytosine deaminase and uridyl phosphoribosyl transferase; negative SM) stably integrated into the 230p locus (PY03857) through double cross-over recombination.

This line is named GIMO mother line (gene insertion/marker out): GIMOPy17x (line 1923cl1).

The GIMO mother line shows a normal development during the complete life cycle, including development in the mosquito and in the liver. This line can therefore be used as a reference line for introduction of transgenes.

The use of these lines greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals (see below).

The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice.

Other mutants
RMgm-687: A GIMO reference motherline of P. berghei (ANKA)


  Other: Mutant parasite with another genetic modification
Details of the target gene
Gene Model of Rodent Parasite PY17X_0306600
Gene Model P. falciparum ortholog PF3D7_0208900
Gene product6-cysteine protein
Gene product: Alternative nameP230p; 230p
Description
Short description of the modificationThe GIMO-mutant contains the hdhfr::yfcu positive-negative selection marker in the silent 230p locus
DescriptionThe mutant expresses a fusion of a drug resistance gene and a drug sensitivity gene, the so called positive-negative selectable marker (SM), constitutively expressed by the P. berghei eef1α promoter. Specifically, the mutant contains a fusion gene of hdhfr (human dihydrofolate reductase; positive SM) and yfcu (yeast cytosine deaminase and uridyl phosphoribosyl transferase; negative SM) stably integrated into the 230p locus (PY03857) through double cross-over recombination.

The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice.

To generate the GIMO mother line in P. yoelii, a modified two step PCR method was used to generate DNA-construct pL1805 for integration into the 230p gene (PY03857) of P. yoelii. In the first PCR reaction two fragments (5’- and 3’- targeting sequences, both ~1kb) of 230p were amplified from P. yoelii 17XNL genomic DNA with the primer sets 6523/6524 (py230p 5’- targeting sequence, F: GAACTCGTACTCCTTGGTGACGGGTACCGTGATGGAATGGCAACATCTG; py230p 5’- targeting sequence, R: CATCTACAAGCATCGTCGACCTCGGTTGGACAATGTAATGCTAC) and 6525/6526 (py230p 3’- targeting sequence, F: CCTTCAATTTCGGATCCACTAGAAGTAAAAGGGGTAAGACAGC; py230p 3’- targeting sequence, R: AGGTTGGTCATTGACACTCAGCAGTACTAAGAGATCTGGAACCAACTGG). Primers 6524 and 6525 have 5’- extensions homologues to the hdhfr::yfcu selectable marker cassette (CATCTACAAGCATCGTCGACCTC in 6524 and CCTTCAATTTCGGATCCACTAG in 6525). This selectable marker cassette was excised by digestion with XhoI and NotI from a plasmid (pL0048) that contains the P. berghei eef1α-hdfhr::yfcu-3’dhfr/ts (i.e. promoter-drug selectable marker-3’ terminator sequence) selection cassette. Primers 6523 and 6526 have 5’-terminal extensions with an anchor-tag suitable for the second PCR reaction. In the second PCR reaction, the amplified 5’- and 3’- targeting sequences were annealed to either side of the selectable marker cassette, and the joint fragment was amplified by the external anchor-tag primers 4661/4662 (anchor-tag primer, F: GAACTCGTACTCCTTGGTGACG; anchor-tag primer, R: AGGTTGGTCATTGACACTCAGC), resulting in the PCR-based targeting construct with an expected size of 4.7 kb (2.7 kb of the selectable marker cassette plus two targeting sequences of 1kb). Before transfection, the PCR-based construct was digested with Asp718I and ScaI (in primers 6523 and 6526, respectively) to remove the ‘anchor-tag’ and with DpnI that digests any residual pL0048 plasmid.