Back to search resultsSummaryRMgm-57
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene mutation |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 10579715 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei NK65 |
Name parent line/clone | Not applicable |
Other information parent line | |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | S. Kappe, V. Nussenzweig, R. Menard |
Name Group/Department | Department of Pathology, Kaplan Cancer Center |
Name Institute | New York University School of Medicine |
City | New York |
Country | USA |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-57 |
Principal name | TMIC |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Not different from wild type |
Sporozoite | Not different from wild type |
Liver stage | Not different from wild type |
Additional remarks phenotype | Mutant/mutation Protein (function) Phenotype Other mutants |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1349800 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1335900 | ||||||||||||||||||||||||||
Gene product | thrombospondin-related anonymous protein | sporozoite surface protein 2 | ||||||||||||||||||||||||||
Gene product: Alternative name | sporozoite surface protein 2; SSP2; SSP-2; TRAP | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Short description of the mutation | The cytoplasmic tail domain (CTD) of TRAP replaced with the CTD of T. gondii MIC2 | ||||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||||
Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||||
Type of plasmid/construct | Plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | pbdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | The construct used results in 'disruption of the wild type trap-gene and introduction of a full length mutated trap gene under control of the wild type regulatory (3'UTR, 5'UTR) sequences. The mutant expresses a mutated form of TRAP (thrombospondin-related anonymous protein) in which 37 carboxy-terminal residues of the cytoplasmic tail are replaced with the cytoplasmic tail of MIC2 which is a TRAP-related protein expressed by tachyzoites of Toxoplasma gondii. The DNA encoding the cytoplasmic tail of MIC2 was amplified from the XhoI fragment of BAC G11-11 (Wan et al., 1997) using 5'primer P27 (5'AAAACTGCAGGATCCCCATCCGCGGAGATAG 3') and 3'primer P28 (5'TGCTCTAGATATATATGTTTATTAAAATTACTCCATCCACATATCACTATCG 3') | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |