RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-149
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1349800; Gene model (P.falciparum): PF3D7_1335900; Gene product: thrombospondin-related anonymous protein | sporozoite surface protein 2 (sporozoite surface protein 2; SSP2; SSP-2; TRAP)
Details mutation: The cytoplasmic tail domain (CTD) of TRAP replaced with the CTD of TLP (Trap-Like Protein (AY484471)
Phenotype Sporozoite; Liver stage;
Last modified: 24 July 2011, 12:21
  *RMgm-149
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18441124
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherK. Heiss, K. Matuschewski
Name Group/DepartmentDepartment of Parasitology
Name InstituteHeidelberg University School of Medicine
CityHeidelberg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-149
Principal namePbTLP (TLP-tail)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of midgut (oocyst-derived) sporozoites are produced. Sporozoites produced normal amounts of the mutated TRAP protein in comparison with TRAP expression in wild type parasites. Reduced numbers of salivary gland sporozoites (43% compared to wild type). Reduced numbers of mature liver-schizonts in Huh7 cells (14% compared to wild type). Infection of Sprague/Dawley rats by inoculation of 10.000 sporozoites consistently resulted in blood stage infections.
Liver stageReduced numbers of mature liver-schizonts in Huh7 cells (14% compared to wild type). Infection of Sprague/Dawley rats by inoculation of 10.000 sporozoites consistently resulted in blood stage infections.
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mutated form of TRAP.  The cytoplasmic tail domain (CTD) of TRAP has been replaced with the CTD of TLP (Trap-Like Protein; TRAP2; PBANKA_111600 ).

Protein (function)
TRAP is a type 1 transmembrane protein, containing two adhesive domains in its extracellular portion, an A-domain of von Willebrand factor and a thrombospondin type I repeat (TSR, TSP). The cytoplasmic part (tail) of the protein is postulated to interact with actin–myosin motor proteins giving the force needed for motility.
TRAP is located in the micronemes of sporozoites. The protein plays a role in the gliding motility of sporozoites and invasion of host cells as has been shown by analysis of mutant parasites lacking expression of TRAP(RMgm-47; RMgm-53).
Analyses of mutants that express TRAP with mutated forms of the cytoplasmic tail have shown the role of this domain for gliding motility and invasion of host cells (see 'Other mutants').

Phenotype
Analyses of other mutants that express TRAP with mutated forms of the cytoplasmic tail have shown the role of this domain for gliding motility and invasion of host cells (see 'Other mutants').

The phenotype analyses of the mutant described here indicate that  that the cytoplasmic tail domain of TLP (Trap-Like Protein; TRAP2; PBANKA_111600 )  can complement the function of cytoplasmic tail domain of TRAP, albeit not as well as TRAP as shown by the (trongly) reduced invasion of salivary glands and hepatocytes.

Additional information

Other mutants
P. berghei mutants with mutated cytoplasmic tails of TRAP (RMgm-54; RMgm-55; RMgm-56; RMgm-57; RMgm-150; RMgm-151).
RMgm-143; RMgm-144: P. berghei mutants lacking expression of TLP (Trap-Like Protein; TRAP2; PBANKA_111600 ).
 


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1349800
Gene Model P. falciparum ortholog PF3D7_1335900
Gene productthrombospondin-related anonymous protein | sporozoite surface protein 2
Gene product: Alternative namesporozoite surface protein 2; SSP2; SSP-2; TRAP
Details of the genetic modification
Short description of the mutationThe cytoplasmic tail domain (CTD) of TRAP replaced with the CTD of TLP (Trap-Like Protein (AY484471)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe construct used results in replacement of the wild type trap-gene with a mutated trap gene. In the mutated trap gene the cytoplasmic tail domain (CTD) of TRAP is replaced with the CTD of TLP (Trap-Like Protein (AY484471). The CTD of TLP was obtained using the following primers: PbTLPfor (5' CGGGATCCAAAAACAAACAAATAATTCCAACTAGC3'; and PbTLPrev (5' TGCTCTAGATCATTTCCATGGAGAATTGTCATTATAATC 3'). The mutated TRAP gene is under the control of the 5'-UTR of TRAP and the 3'-UTR of pbdhfr.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6