RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-774
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1355700; Gene model (P.falciparum): PF3D7_1342600; Gene product: myosin A (MyoA; M-A)
Details mutation: 'Promoter swap' mutant: the promoter of myosin A replaced by the promoter of ama1 (PBANKA_091500)
Phenotype Fertilization and ookinete;
Last modified: 22 September 2012, 21:45
  *RMgm-774
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22817984
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherS. Sebastian; O. Billker
Name Group/DepartmentNot applicable
Name InstituteWellcome Trust Sanger Institute
CityHinxton, Cambridge
CountryUK
Name of the mutant parasite
RMgm numberRMgm-774
Principal namePama1-myoa
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of mature ookinetes are formed. Expression of MyoA was absent in mutant ookinetes. Ookinetes are devoid of motility.
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
In the promoter swap' mutant: the promoter of the endogenous myosin A gene is replaced by the promoter of ama1 (PBANKA_091500).

Protein (function)
Myosin A is the founding member of unconventional class XIV myosins. These myosins are remarkably small, essentially composed of the actin-interacting ATPase domain, followed by a very short tail domain. Class XIV myosins are exclusively found in the Alveolata branch of eukaryotic organisms, including the Apicomplexa. Plasmodium Myosin A is considered vital for merozoite invasion of erythrocytes. Myosin A is a component of the glideosome of apicomplexan parasites, which is an actin- and myosin-based machine located at the pellicle, between the plasma membrane (PM) and inner membrane complex (IMC), that powers parasite motility, migration, and host cell invasion and egress. It is composed of myosin A, its light chain MLC1, and two gliding-associated proteins, GAP50 and GAP45

Phenotype
Myosin A is considered vital for blood stage development/multiplication (merozoite invasion of erythrocytes).
In the 'promoter-swap' mutant the promoter of myosin A is replaced by an 'asexual blood stage’ promoter that is silent (or has a strongly reduced activity) in ookinetes (the promoter of ama1, PBANKA_091500). Expression of MyoA was absent in mutant ookinetes whereas wild type ookinetes express MyoA.

Phenotype analyses of the promoter swap mutant indicate that Myosin A has an essential role in ookinete motility

Additional information

Other mutants
RMgm-656: independent promoter exchange mutant expressing MyoA from the ama1 promoter


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1355700
Gene Model P. falciparum ortholog PF3D7_1342600
Gene productmyosin A
Gene product: Alternative nameMyoA; M-A
Details of the genetic modification
Short description of the mutation'Promoter swap' mutant: the promoter of myosin A replaced by the promoter of ama1 (PBANKA_091500)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor the double-crossover promoter-exchange plasmid, a parent vector Pama1 was first constructed containing the ama1 promoter. For Pama1, 1.5 kb of the upstream sequence of the ama1 gene (PBANKA_083630) was cloned downstream of the hdhfr cassette in pDEFhDHPEA. The Pama1-myoA (pSS368) vector was subsequently made by inserting a myoA 5’ homology region upstream of the hdhfr cassette in Pama1 (consisting of 500 bp of myoA upstream sequence), and a 3’ homology region downstream of the ama1 promoter (consisting of the first 500 bp of myoA coding sequence)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gagaccgcggcattgaagaattgtattttgttac
Additional information primer 1olSS1066; 5’HR MyoA forward
Sequence Primer 2gagactgcagcgagaaacgagaaaaatcaaaatt
Additional information primer 2olSS1067; 5’HR MyoA reverse
Sequence Primer 3gagactcgagatggctgttacaaatgaggaat
Additional information primer 3olSS1068; 3’HR MyoA forward
Sequence Primer 4gagagcggccgcgttaacgccatgtaaatttgataaag
Additional information primer 4olSS1069; 3’HR MyoA reverse
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6