RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-656
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1355700; Gene model (P.falciparum): PF3D7_1342600; Gene product: myosin A (MyoA)
Details mutation: 'promoter-swap' mutant; the promoter of myosin A replaced by the promoter of ama1 (PBANKA_091500)
Phenotype Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 14 October 2011, 17:20
  *RMgm-656
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21899701
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent lineno details of the parasite line are provided
The mutant parasite was generated by
Name PI/ResearcherI. Siden-Kiamos; K. Matuschewski
Name Group/DepartmentInstitute of Molecular Biology and Biotechnology
Name InstituteFoundation for Research and Technology- Hellas
CityHeraklion, Crete
CountryGreece
Name of the mutant parasite
RMgm numberRMgm-656
Principal nameMyoA absent in ookinete (Mao)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of mature ookinetes are formed. Expression of MyoA was absent in mutant ookinetes. Ookinetes are devoid of motility. Oocyst production was strongly reduced
OocystOokinetes are devoid of motility. Oocyst production was strongly reduced
SporozoiteSee 'Additional remarks phenotype'
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
In the 'promoter-swap' mutant the promoter of myosin A is replaced by an 'asexual blood stage’ promoter that is silent (or has a strongly reduced activity) in ookinetes (the promoter of ama1, PBANKA_091500). Expression of MyoA was absent in mutant ookinetes whereas wild type ookinetes express MyoA.

Protein (function)
Myosin A is the founding member of unconventional class XIV myosins. These myosins are remarkably small, essentially composed of the actin-interacting ATPase domain, followed by a very short tail domain. Class XIV myosins are exclusively found in the Alveolata branch of eukaryotic organisms, including the Apicomplexa. Plasmodium Myosin A is considered vital for merozoite invasion of erythrocytes. Myosin A is a component of the glideosome of apicomplexan parasites, which is an actin- and myosin-based machine located at the pellicle, between the plasma membrane (PM) and inner membrane complex (IMC), that powers parasite motility, migration, and host cell invasion and egress. It is composed of myosin A, its light chain MLC1, and two gliding-associated proteins, GAP50 and GAP45

Phenotype
Myosin A is considered vital for blood stage development/multiplication (merozoite invasion of erythrocytes).

In the 'promoter-swap' mutant the promoter of myosin A is replaced by an 'asexual blood stage’ promoter that is silent (or has a strongly reduced activity) in ookinetes (the promoter of ama1, PBANKA_091500). Expression of MyoA was absent in mutant ookinetes whereas wild type ookinetes express MyoA.

Phenotype analyses of the promoter swap mutant indicates that Myosin A has an essential role in ookinete motility (and subsequent oocyst development)

Additional information
Oocysts of the promoter mutant produced normal numbers of sporozoites which invaded salivary glands. These sporozoites produced Myosin A and were motile. Mutant oocysts were obtained by micro-injection of cultured, mature ookinetes into the haemocoel/thorax of mosquitoes.

Other mutants


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1355700
Gene Model P. falciparum ortholog PF3D7_1342600
Gene productmyosin A
Gene product: Alternative nameMyoA
Details of the genetic modification
Short description of the mutation'promoter-swap' mutant; the promoter of myosin A replaced by the promoter of ama1 (PBANKA_091500)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid HpaI
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor the 'promoter swap' construct a 1.1 kb 3’ deleted PbMyoA fragment was amplified with primers MyoAfor-BamHI and MyoArev-NdeI. In addition, a 1.3 kb region covering the PbAMA1 promoter was amplified using the primers AMA1for and AMA1rev.

A single cross-over event at the site of linearization within the 5' region of the MyoA open reading frame leads to an upstream copy that contains the endogenous promoter before a 3' deleted, non-functional MyoA copy. Downstream of this copy is the positive selectable marker and a functional copy consisting of a full-length MyoA allele, which is
under the control of the ama1 promoter.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CGCGGATCCAAAATGGCTGTTACAAATGAGGAATTAAAAAC
Additional information primer 1MyoAfor-BamHI
Sequence Primer 2GGGAATTCCATATGATTACCTAATGTTAAAATACCCGC
Additional information primer 2MyoArev-NdeI
Sequence Primer 3CGGAATTCTTCTATAAACTAATACAAACCCCG
Additional information primer 3AMA1for (EcoRI)
Sequence Primer 4CGGGATCCTATTTCTTTCATTTTTATATCG
Additional information primer 4AMA1rev (BamHI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6