RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-858
Malaria parasiteP. yoelii
Genotype
Transgene
 Transgene not Plasmodium: GFP-Luciferase
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr-ts)
Replacement locus: Gene model: PY05712; Gene product: Zinc finger C-x8-C-x5-C-x3-H type, putative (S1)
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite; Liver stage;
Last modified: 21 April 2013, 19:44
  *RMgm-858
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23593316
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherMiller, JL; Kappe, SHI
Name Group/DepartmentSeattle Biomedical Research Institute
Name InstituteSeattle Biomedical Research Institute
CitySeattle
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-858
Principal namePy-GFP-luc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageGFP-Luciferase expression
Gametocyte/GameteGFP-Luciferase expression
Fertilization and ookineteGFP-Luciferase expression
OocystGFP-Luciferase expression
SporozoiteGFP-Luciferase expression
Liver stageGFP-Luciferase expression
Additional remarks phenotype

Mutant/mutation
The mutant expresses the fusion protein GFP-Luciferase under the control of the constitutive P. berghei eef1α promoter. The gfp-luciferase expression casette has been introduced into the s1 locus. The s1-locus is dispensable for the complete life cycle

Phenotype
GFP-luciferase is expressed in all life cycle stages and expression of the transgene has no influence on parasite viability and infectivity.

Additional information

Other mutants
See also mutant RMgm-689: This is also a P. yoelii XNL line that expresses GFP-Luciferase under control of the P. berghei eef1a promoter. The transgene is inserted into the silent 230p locus. This mutant has been generated by the GIMO method of transfection and does not contain a drug-selectable marker.

  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP-Luciferase
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationP. yoelii 17XNL genomic DNA (gDNA) was used as a template to amplify a 0.5 kb fragment of the 3'UTR and a 0.5 kb fragment of the 5'UTR of PyS1 using oligonucleotide primers PyS1-1 EcoRV forward (F) and PyS1–2 ApaI reverse (R) and PyS1–3 ApaI F and PyS1–4 NotI R (primer sequences provided below). PyS1–2 R and PyS1–3 F contained a unique ApaI site and overlapping sequences. The 59UTR and 39UTR fragments were then combined by splicing by overlapping extension (SOE) PCR, and the resulting fragment was inserted into the plasmid b3D.DT.H Db-DsRed (Mikolajczak et al., 2008. Mol. Biochem. Parasitol.) between EcoRV and NotI restriction enzymes sites. The plasmid was then digested with KpnI and AflII to replace the red fluorescent protein cassette with the green fluorescent protein-luciferase cassette derived from pL1063. This plasmid was obtained through MR4 (P. berghei pL1063, MRA-852). The resulting plasmid was digested with ApaI between the 59 and 39 UTRs to linearize the plasmid for transfection.
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr-ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PY05712
Gene productZinc finger C-x8-C-x5-C-x3-H type, putative
Gene product: Alternative nameS1
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1atgatatcagacacttataaagctaaagaag
Additional information primer 1PyS1-1 EcoRV F
Sequence Primer 2gaagaaatatggggccctacaaatttcgatgcactca
Additional information primer 2PyS1-2 Apa1 R
Sequence Primer 3gaaatttgtagggccccatatttcttctcattttcc
Additional information primer 3PyS1-3 Apa1 F
Sequence Primer 4atgcggccgcgatgagaataataatatgtagataa
Additional information primer 4PyS1-4 Apa1 R
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren