| top of page |
| Type and details of transgene |
| Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
| Transgene name | GFP-Luciferase |
| top of page |
| Details of the genetic modification |
| Inducable system used | No |
| Additional remarks inducable system |
|
| Type of plasmid/construct | Plasmid double cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Selectable marker used to select the mutant parasite | tgdhfr |
| Promoter of the selectable marker | pbdhfr |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | P. yoelii 17XNL genomic DNA (gDNA) was used as a template to amplify a 0.5 kb fragment of the 3'UTR and a 0.5 kb fragment of the 5'UTR of PyS1 using oligonucleotide primers PyS1-1 EcoRV forward (F) and PyS1–2 ApaI reverse (R) and PyS1–3 ApaI F and PyS1–4 NotI R (primer sequences provided below). PyS1–2 R and PyS1–3 F contained a unique ApaI site and overlapping sequences. The 59UTR and 39UTR fragments were then combined by splicing by overlapping extension (SOE) PCR, and the resulting fragment was inserted into the plasmid b3D.DT.H Db-DsRed (Mikolajczak et al., 2008. Mol. Biochem. Parasitol.) between EcoRV and NotI restriction enzymes sites. The plasmid was then digested with KpnI and AflII to replace the red fluorescent protein cassette with the green fluorescent protein-luciferase cassette derived from pL1063. This plasmid was obtained through MR4 (P. berghei pL1063, MRA-852). The resulting plasmid was digested with ApaI between the 59 and 39 UTRs to linearize the plasmid for transfection. |
| Additional remarks selection procedure | |
| top of page |
| Other details transgene |
| top of page |
| Promoter |
| Gene Model of Parasite |
PBANKA_1133300
|
| Gene Model P. falciparum ortholog |
PF3D7_1357100
|
| Gene product | elongation factor 1-alpha |
| Gene product: Alternative name | eef1a |
Primer information details of the primers used for amplification of the promoter sequence 
Primer information details of the primers used for amplification of the promoter sequence
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| top of page |
| 3'-UTR |
| Gene Model of Parasite |
PBANKA_0719300
|
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
| Gene product: Alternative name | dhfr-ts |
Primer information details of the primers used for amplification the 3'-UTR sequences 
Primer information details of the primers used for amplification the 3'-UTR sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| Insertion/Replacement locus |
| Replacement / Insertion | Replacement locus |
| Gene Model of Parasite |
PY05712
|
| Gene product | Zinc finger C-x8-C-x5-C-x3-H type, putative |
| Gene product: Alternative name | S1 |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
| Sequence Primer 1 | atgatatcagacacttataaagctaaagaag |
| Additional information primer 1 | PyS1-1 EcoRV F |
| Sequence Primer 2 | gaagaaatatggggccctacaaatttcgatgcactca |
| Additional information primer 2 | PyS1-2 Apa1 R |
| Sequence Primer 3 | gaaatttgtagggccccatatttcttctcattttcc |
| Additional information primer 3 | PyS1-3 Apa1 F |
| Sequence Primer 4 | atgcggccgcgatgagaataataatatgtagataa |
| Additional information primer 4 | PyS1-4 Apa1 R |
|
|
| top of page |