Summary

RMgm-689
Malaria parasiteP. yoelii
Genotype
Transgene
Transgene not Plasmodium: GFP-Luciferase
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Insertion locus: Gene model: PY17X_0306600; Gene product: 6-cysteine protein (P230p; 230p)
Phenotype Asexual bloodstage; Gametocyte/Gamete; Oocyst; Sporozoite; Liver stage;
Last modified: 24 December 2016, 17:38
  *RMgm-689
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22216235
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone RMgm-688
Other information parent lineGIMO-Py17X (RMgm-688)contains as a selectable marker (SM) the fusion gene of hdhfr (human dihydrofolate reductase; positive SM) and yfcu (yeast cytosine deaminase and uridyl phosphoribosyl transferase; negative SM) stably integrated into the 230p locus (PY04774) through double cross-over recombination. The SM is under control of the P. berghei eef1α promoter. This reference line of P. yoelii 17XNL line is used for rapid introduction of transgenes free of drug-resistance genes (RMgm-688; PubMed: PMID: 22216235).
The mutant parasite was generated by
Name PI/ResearcherJ. Lin; C.J. Janse; S.M. Khan
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-689
Principal namePyGFP-luc(con); PyGFP-luccon
Alternative name1971cl1, cl2, cl3
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageGFP-Luciferase expression in all stages; increase of GFP-Luciferase expression during development from ring form into mature trophozoite/immature schizont; decrease of GFP-Luciferase expression in mature schizonts.
Gametocyte/GameteGFP-Luciferase expression in female and male gametocytes
Fertilization and ookineteNot tested
OocystStrong GFP-Luciferase expression in maturing oocysts
Sporozoite(Weak) GFP-Luciferase expression in salivary gland sporozoites
Liver stageStrong GFP-Luciferase expression in maturing liver stages
Additional remarks phenotype

Mutant/mutation
The mutant expresses the fusion protein GFP-Luciferase under the control of the constitutive P. berghei eef1a promoter. The mutant does not contain a drug-selectable marker.

The mutant has been generated and selected using the GIMO transfection method ('gene insertion/marker out') of transfection of GIMO mother lines that contain the hdhfr::yfcu selectable marker into the silent 230p locus.

The mutant has been generated in the reference line GIMOPy17x (RMgm-688). The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice.

Phenotype
GFP-Luciferase is expressed in all life cycle stages and expression of the transgene has no influence on parasite viability and infectivity.

Additional information
To introduce the GFP-Luciferase into the 230p locus a PCR-amplified construct was used. See 'Additional remarks genetic modification' for details of the generation of the construct. Such 'GIMO-constructs' contain only the two genome targeting sequences and the transgene expression cassette. The simple structure of GIMO constructs permits the cloning of larger transgenes (the GIMO constructs are smaller as the selectable marker cassette is absent) and improves the retention of plasmids in bacteria as internally repetitive regions of AT-rich Plasmodium DNA are absent. Further, after transfection with the GIMO construct, the selection of integration mutants is improved as no episomal construct DNA is maintained in the parasites and negative selection kills parasites expressing yfcu.

Other mutants
RMgm-29: A P. berghei mutant expressing the fusion protein GFP-Luciferase under the control of the constitutive P. berghei eef1a promoter. The mutant does not contain a drug-selectable marker.


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP-Luciferase
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGC
ACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGC
TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAA
TTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTG
GTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTGAACTC
GTACTCCTTGGTGACGGGTACCGTGATGGAATGGCAACATCTGATCACATTTTAAAAATA
GTTGATGATGATAGTAAAACGATTAAATATTTTAACGATATACCTTATCAGATGTGTAAT
TTTGATTATAATTTAAGCAAATTAAGTGAAATACAAATATGTGAAAAAACAATAAATGAA
TTTAGTTTATTCATGTATAATTGTGAGCAAATAACAGATAATAGAATCGTATATGGTAAA
GAACCTATTAATACCATAAAATATTTAAGTAATGTATTTCCTATAAATAAATTTACAGAT
TTATTTTTTAATACAAAAGATATAGATATACCAGAAATAAATGAACAATTTAAAGGTTTT
AAATTTTTTATGACCTCATTTATAAATCATGGATCATATCCACTAACCATAGAATGTGGT
GTAACAAATGGTGGGACTGATTATAGAAGAGCAATTATTTTATTACATGTTCGAACAGAT
TTAAAAGATAGACCAGTTTCATTTTGTGATTTTAGAAAAGGTGAATTATATAATTATTTA
AATGCTTATAGTGAAGGAGATCTATGTATAATAATTTCCAAATCAAATACAAGTTTTGGT
TTTAGATGCCCCGAAAATACAAAAAAAATGCCAGAAAAATGTTTTACTCAAGTATATGAA
AAAGGCTATCTACATGATTCCTATAAAATTAATACTAAAAATATTATTAACTATTCATTT
GAAAATCCAGAATATGCATTAGCTGGTTTTAATTATACATTAACAAAATCATATCAATTT
GAATGTCATTGTGTAGATAAAGAAACAGAACAAATTGTAAAAACTGTTTTAGTAAAATAT
GTAAATGAAGATGAAATATATGATTATAATGATTTACCATTGGTTAATCATAAATCTATT
GTTGCACATCCAAATAAAACACATCTATGTGACTTTATGACATCTGATAATATGTTATCA
CCTAAAAAAGAAGATTCAGTAAATTATGTTTGTAATGTATTTCCAAAACCATTAGAATAT
GTAGCATTACATTGTCCAACCGAGGTCGACGATGCTTGTAGATGCCCGGGGCCCAGCTTA
ATTCTTTTCGAGCTCTTTATGCTTAAGTTTACAATTTAATATTCATACTTTAAGTATTTT
TTGTAGTATCCTAGATATTGTGCTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTT
CATCCACTGAAATACCATTAAATTTTCAAAAAAATACTATGCATATAATGTTATACATAT
AAACATAAAACGCCATGTAAATCAAAAAATATATAAAAATATGTATAAAAATAAATATGC
ACTAAATATAAGCTAATTATGCATAAAAATTAAAGTGCCCTTTATTAACTAGTCGTAATT
ATTTATATTTCTATGTTATAAAAAAATCCTCATATAATAATATAATTAATATATGTAATG
TTTTTTTTATTTTATAATTTTAATATAAAATAATATGTAAATTAATTCAAAAAATAAATA
TAATTGTTGTGAAACAAAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTT
TAATATTTCCTAAAATATATATACTTTGTGTATAAATATATAAAAATATATATTTGCTTA
TAAATAAATAAAAAATTTTATAAAACATAGGGGGATCTATGAGTAAAGGAGAAGAACTTT
TCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTT
CTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTT
GCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTG
TTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCA
TGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGA
CACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTA
TTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCAC
ACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTA
GACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAA
TTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTT
CGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTG
GGATTACACATGGCATGGATGAACTATACAAAGGGATCCTGGCTAGCCAGTCGACCTGCA
GGCATGCAAGCTTGCGGCCGATCCAAATGGAAGACGCCAAAAACATAAAGAAAGGCCCGG
CGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGA
GATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGAACATCA
CGTACGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGC
TGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGG
TGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAAC
GTGAATTGCTCAACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTCCAAAAAGG
GGTTGCAAAAAATTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAAATTATTATCA
TGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATC
TACCTCCCGGTTTTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGACAAAACAA
TTGCACTGATAATGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGCCCTTCCGC
ATAGAACTGCCTGCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCA
TTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTA
CACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGC
TGTTTTTACGATCCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACCAACCCTAT
TTTCATTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAA
TTGCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAAACGCTTCC
ATCTTCCAGGGATACGACAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTA
CACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGA
AGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGCGAATTATGTG
TCAGAGGACCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGA
TTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACT
TCTTCATAGTTGACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGTGGCCCCCG
CTGAATTGGAATCGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGTGGCAGGTC
TTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGA
CGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGT
TGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACG
CAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAAT
TCTAGAAGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAACTG
TAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCT
AAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGC
TAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTAAAA
ATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTATTAT
TATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTG
ATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAA
AAAAAACATATAAACACAAATGATGTTTTTTCCTTCAACCCGGGCCTTCAATTTCGGATC
CACTAGAAGTAAAAGGGGTAAGACAGCAATTGTTAAAATTAATGTTCATCCAAATTCTTT
AAAGATTATGGGATGTGATTTTGTCGGAGCATATTCTTCTTATTTTATATTTAGTAAAAA
ATGGGATCAAATAACTCCAAATTATGTTTGTGAAATTAATGTAGAAGATGATTCTATTAT
TGGATTGGCTTGTCCTTATAATACAAAAATATATCCTTCTGATTGTTTTGAAAGTGTTAT
AAAAAATAATAAAGTTTACAAAAGAGATACCTTAATTGAATATAAAAATACATTTTTTTA
TCAAAAAAATGGAAAACCTACATTATCTTTTATACAAATTAAAAAAGTTTATTCTGACCA
TCTTACTTGTAAGTGCTTTGAAAATAATAATGGAAATTACAAAGAAGTTACTATCAAATT
AATTTATAAATCATATATATTAGGAACACCAAAAATGACTTTAAATAAACCATTTATGAA
ATATAAAAGTGTTAATTTTTTGGATTATCTGATTGGGAAGAAATTCTAATTTTTATAGTA
TCCCCAGCCCCTTTTGATTCAATATAGTTTTAGCTTGCCGATTTCTTTGGGTTCGTGTTT
TGCGATTTCTTTGGGTTCGTGTTTTGCGATTTCTTTGGGTTCGTGTTTTGCGATTTGTTT
GGGTTCGTGTTTTGCGATTTGTTTGGGTTCGTGTTTTGTGATTTCTTTGCGATTTTTGTG
TGTTTAGTGATTTTTGTGTGTGTCGATTGTGCGTTTTTTATTATATTATTGTTATCATAT
TTGATTTACCTTTTGATATTAGGACATATATATATGCATATATTTTTTTGTATTTCCTGA
TTTGTTTGTGATCATAATTTTCGATAAAATGAGTTTTTATTATTGATGCTTTAAACATTC
CAGTTGGTTCCAGATCTCTTAGTACTGCTGAGTGTCAATGACCAACCTAAGGGCGAATTC
TGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCC
TATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAAC
CCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAAT
AGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGG
ACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCG
CTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCA
CGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTA
GTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGC
CATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTG
GACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTAT
AAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTA
ACGCGAATTTTAACAAAATTCAGGGCGCAAGGGCTGCTAAAGGAAGCGGAACACGTAGAA
AGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGAC
AAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATA
GCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTC
TGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTG
ATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGA
ACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGA
CTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGG
GCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGA
GGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGT
TGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCT
GTCATCCCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCT
GCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCG
AGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCA
GGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGA
TCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTT
TTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTT
GGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCT
TTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTT
CTTCTGAATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCC
TTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAA
GATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGT
AAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTT
CTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGC
ATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACG
GATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCG
GCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAAC
ATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCA
AACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTA
ACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGAT
AAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAA
TCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAG
CCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAAT
AGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTT
TACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTG
AAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGA
GCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTA
ATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAA
GAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACT
GTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACA
TACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTT
ACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGG
GGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAG
CGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTA
AGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTAT
CTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCG
TCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCC
TTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAAC
CGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGC
GAGTCAGTGAGCGAGGAAGCGGAAG
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedureNo
Selection (negative) procedure5-fluorocytosine (5-FC)
Additional remarks genetic modificationFirst a basic P. yoelii 230p-targeting construct (pL1849) was generated using a modified 2-step PCR method. In the first PCR reaction, 5’-and 3’- targeting sequences (both ~1kb) of 230p were amplified from P. yoelii 17XNL genomic DNA with the primer set 6523/6524 (py230p 5’- targeting sequence, F: GAACTCGTACTCCTTGGTGACGGGTACCGTGATGGAATGGCAACATCTG; py230p 5’- targeting sequence, R: CATCTACAAGCATCGTCGACCTCGGTTGGACAATGTAATGCTAC) and 6525/6526 (py230p 3’- targeting sequence, F: CCTTCAATTTCGGATCCACTAGAAGTAAAAGGGGTAAGACAGC; py230p 3’- targeting sequence, R: AGGTTGGTCATTGACACTCAGCAGTACTAAGAGATCTGGAACCAACTGG). These primers contain 5’- extensions homologues to the hdhfr::yfcu selectable marker cassette and 5’-terminal extensions with an anchor-tag suitable for the second PCR reaction. A 55nt oligo (oligo 6598; GAGGTCGACGATGCTTGTAGATGCCCGGGCCTTCAATTTCGGATCCACTAG) containing a XmaI restriction site flanked by 2 sequences homologues to the hdhfr::yfcu selectable marker cassette was used to join the two 230p targeting regions. In the second PCR reaction an fragment containing both 230p targeting sequences interrupted by the XmaI site was amplified, using the external anchor-tag primers 4661/4662 (anchor-tag primer, F: GAACTCGTACTCCTTGGTGACG; anchor-tag primer, R: AGGTTGGTCATTGACACTCAGC), resulting in the PCR product of ~2 kb. The PCR product was cloned into TOPO TA vector (TOPO TA Cloning® Kit, Invitrogen, Groningen, The Netherlands) resulting in construct pL1849.

Next a construct (pL1847) for GIMO-transfection in the GIMOPy17X mother line was generated by cloning an PCR-amplified GFP-luciferase expression cassette into the XmaI site of the basic P. yoelii 230p targeting construct pL1849 (see above). The GFP-luciferase expression cassette (5’ eef1α-gfp::luciferase-3’pbdhfr) was amplified from pL1603 (MRA-852, www.mr4.org) using primers 6599 and 6600 (5’pbeef1α, F: TCCCCCCGGGGCCCAGCTTAATTCTTTTCGAGCTC; 3’pbdfhr/ts, R: TCCCCCCGGGTTGAAGGAAAAAACATCATTTGTG).
Additional remarks selection procedureThis reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker.
The mutant has been generated in the reference line GIMOPy17x (RMgm-688). The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite PY17X_0306600
Gene product6-cysteine protein
Gene product: Alternative nameP230p; 230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4