RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-852
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1411100; Gene model (P.falciparum): PF3D7_1312600; Gene product: 2-oxoisovalerate dehydrogenase subunit alpha, mitochondrial, putative (BCDH-E2)
Name tag: GFP
Phenotype Asexual bloodstage;
Last modified: 29 April 2013, 09:53
  *RMgm-852
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23490300
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherFalkard B; Fidock D
Name Group/DepartmentDepartment of Microbiology and Immunology
Name InstituteColumbia University Medical Center
CityNew York
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-852
Principal nameBCDH-E2-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationNo
top of page
Phenotype
Asexual blood stageBCDH-E2-GFP expression in blood stages.
Live-cell imaging of BCDH-E2-GFP parasites stained with MitoTracker Red localized this fusion protein to the mitochondria. In contrast, BCDH-E2-GFP did not colocalize with the apicoplast, which was visualized using antibodies against the apicoplast-specific protein ACP (PBANKA_030560; acyl carier protein).
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
 The mutant expresses a C-terminal GFP-tagged version of BCDH-E2

Protein (function)
The protein is part of the mitochondrial alpha-ketoglutarate dehydrogenase complex and evidence exists for lipoylation of BCDH-E2 in the mitochondrion (see also mutant RMgm-851 that lacks expression of LipB for more information)

Phenotype
BCDH-E2-GFP expression in blood stages.
Live-cell imaging of BCDH-E2-GFP parasites stained with MitoTracker Red localized this fusion protein to the mitochondria. In contrast, BCDH-E2-GFP did not colocalize with the apicoplast, which was visualized using antibodies against the apicoplast-specific protein ACP (PBANKA_030560; acyl carier protein).

Additional information
Evidence is presented that BCDH-E2 is NOT located in the apicoplast.

Other mutants

  Tagged: Mutant parasite with a tagged gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1411100
Gene Model P. falciparum ortholog PF3D7_1312600
Gene product2-oxoisovalerate dehydrogenase subunit alpha, mitochondrial, putative
Gene product: Alternative nameBCDH-E2
top of page
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid BsmBI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo localize BCDH, we generated the plasmid pL0031-BCDH-GFP. For this, 875 bp of the 3’ end of bcdh-E2 (PlasmoDB ID: PBANKA_141110) coding sequence was PCR amplified from ANKA genomic DNA using the primers P2872 + P2873. The product was cloned between the SacII / NcoI sites in pL0031 (Kooij et al., 2005) to create a bcdh-gfp fusion. This construct, containing the T. gondii dhfr-ts marker, was linearized with BsmBI prior to electroporation into P. berghei ANKA.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TCACCGCGGTATGCCAATATAGAGAAACTGG
Additional information primer 1P2872 (SacII)
Sequence Primer 2TGACCATGGATTTTCAAATCTTGAAGTGTCAT
Additional information primer 2P2873 (NcoI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren