RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-852

Malaria parasite	P. berghei
Genotype
Tagged	Gene model (rodent): PBANKA_1411100; Gene model (P.falciparum): PF3D7_1312600; Gene product: 2-oxoisovalerate dehydrogenase subunit alpha, mitochondrial, putative (BCDH-E2) Name tag: GFP
Phenotype	Asexual bloodstage;

Last modified: 29 April 2013, 09:53

*RMgm-852

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene tagging
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 23490300
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	Falkard B; Fidock D
Name Group/Department	Department of Microbiology and Immunology
Name Institute	Columbia University Medical Center
City	New York
Country	USA
top of page
Name of the mutant parasite
RMgm number	RMgm-852
Principal name	BCDH-E2-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	No
top of page
Phenotype
Asexual blood stage	BCDH-E2-GFP expression in blood stages. Live-cell imaging of BCDH-E2-GFP parasites stained with MitoTracker Red localized this fusion protein to the mitochondria. In contrast, BCDH-E2-GFP did not colocalize with the apicoplast, which was visualized using antibodies against the apicoplast-specific protein ACP (PBANKA_030560; acyl carier protein).
Gametocyte/Gamete	Not tested
Fertilization and ookinete	Not tested
Oocyst	Not tested
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant expresses a C-terminal GFP-tagged version of BCDH-E2 Protein (function) The protein is part of the mitochondrial alpha-ketoglutarate dehydrogenase complex and evidence exists for lipoylation of BCDH-E2 in the mitochondrion (see also mutant RMgm-851 that lacks expression of LipB for more information) Phenotype BCDH-E2-GFP expression in blood stages. Live-cell imaging of BCDH-E2-GFP parasites stained with MitoTracker Red localized this fusion protein to the mitochondria. In contrast, BCDH-E2-GFP did not colocalize with the apicoplast, which was visualized using antibodies against the apicoplast-specific protein ACP (PBANKA_030560; acyl carier protein). Additional information Evidence is presented that BCDH-E2 is NOT located in the apicoplast. Other mutants

Tagged: Mutant parasite with a tagged gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1411100

Gene Model P. falciparum ortholog

PF3D7_1312600

Gene product

2-oxoisovalerate dehydrogenase subunit alpha, mitochondrial, putative

Gene product: Alternative name

BCDH-E2

top of page

Details of the genetic modification

Name of the tag

GFP

Details of tagging

C-terminal

Additional remarks: tagging

Commercial source of tag-antibodies

Type of plasmid/construct

Plasmid single cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

BsmBI

Selectable marker used to select the mutant parasite

tgdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

To localize BCDH, we generated the plasmid pL0031-BCDH-GFP. For this, 875 bp of the 3’ end of bcdh-E2 (PlasmoDB ID: PBANKA_141110) coding sequence was PCR amplified from ANKA genomic DNA using the primers P2872 + P2873. The product was cloned between the SacII / NcoI sites in pL0031 (Kooij et al., 2005) to create a bcdh-gfp fusion. This construct, containing the T. gondii dhfr-ts marker, was linearized with BsmBI prior to electroporation into P. berghei ANKA.

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	TCACCGCGGTATGCCAATATAGAGAAACTGG
Additional information primer 1	P2872 (SacII)
Sequence Primer 2	TGACCATGGATTTTCAAATCTTGAAGTGTCAT
Additional information primer 2	P2873 (NcoI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page