RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-851
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0707000; Gene model (P.falciparum): PF3D7_0823600; Gene product: lipoate-protein ligase B (LipB)
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Liver stage;
Last modified: 9 June 2013, 15:51
  *RMgm-851
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23490300
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 676m1cl1 (RMgm-29)
Other information parent line676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherFalkard B; Fidock D
Name Group/DepartmentDepartment of Microbiology and Immunology
Name InstituteColumbia University Medical Center
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-851
Principal namePbΔLipB
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageReduced infectivity of sporozoites. Mice infected with sporozoites show a 4 day delay in prepatent period. Mutant liver stages have major defects during late liver stage development and do not produce detached cells during in vitro culture.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of lipoate-protein ligase B (LipB) and expresses GFP-Luciferase under the constitutive eef1a promoter (a second independent mutant has been generated in wild type P. berghei ANKA background)

Protein (function)
The FAS-II pathway generates an eight-carbon chain precursor (octanoic acid) that is used for the synthesis of lipoic acid (6,8-thioctic acid), a cyclic disulphide-containing derivative of octanoic acid that is an essential cofactor for a number of multienzyme complexes found in almost all eukaryotic cells.
In addition to being synthesized de novo, lipoic acid can also be absorbed from dietary sources. Cells maintain active systems to scavenge non-protein bound lipoic acid from their environment.
In Plasmodium, covalently attached lipoic acid regulates the function of three a-ketoacid dehydrogenases, namely pyruvate dehydrogenase (PDH), a-ketoglutarate dehydrogenase (KGDH) and branched-chain α-ketoacid dehydrogenase (BCDH).  These multi-enzyme complexes contribute to amino acid and energy metabolism and consist of multiple copies of a substrate-specific a-ketoacid decarboxylase (the E1 subunit), an acyltransferase (the E2 subunit) and a dihydrolipoamide dehydrogenase (the E3 subunit). These a-ketoacid dehydrogenases generally convert an a-ketoacid, NAD+ and coenzyme A (CoA) to CO2, NADH and acyl-CoA.
PDH, comprised of the lipoylated subunit E2 as well as subunits E1 and E3, is located in the parasite apicoplast.
In the apicoplast, PDH is thought to catalyze the oxidative decarboxylation of pyruvate to generate acetyl-CoA. In contrast to PDH-E2, the other lipoylated proteins (KGDH-E2, BCDH-E2 and the H-protein) have been localized to the mitochondria.

Plasmodium
parasites synthesize lipoic acid within the apicoplast, where the FAS-II pathway produces octanoic acid attached to acyl-carrier protein (ACP) as one of its products. The derivation of lipoic acid from octanoyl-ACP requires two apicoplast-targeted enzymes: octanoyl-ACP transferase (LipB) and lipoate synthase (LipA). LipB transfers the octanoyl group to a lipoyl-accepting domain, whereas LipA is responsible for catalyzing the introduction of two sulphurs at positions 6 and 8, forming the lipoyl group. LipA is capable of generating lipoic acid from the octanoyl-ACP precursor before or after its transfer by LipB, although it is thought that LipA prefers the E2 protein bound substrate. In the apicoplast, these enzymes mediate the attachment of lipoic acid to PDH-E2 . In P. falciparum, LipB was earlier shown to be important for lipoylating PDH-E2 but was itself nonessential to blood stage replication. LipB-deficient (PfLipB) parasites were reported to have an increased growth rate during the asexual blood stages, a reduced level of lipoylated PDH-E2 protein, and a reduction in the total lipoic acid content in the parasite. The lipoate protein ligase LplA2, which is apparently targeted to both the apicoplast and the mitochondria, was hypothesized to compensate for the loss of PfLipB function and to account for the residual PDH-E2 lipoylation that was observed in those knockout (KO) parasites

In addition to the lipoic acid synthesis pathway, Plasmodium parasites have an active scavenging pathway that appears to be essential for both blood- and liver stage development and that has been shown to lead to lipoylation of KGDH-E2, BCDH-E2 and the H-protein in the mitochondrion. Host lipoic acid may be imported via the parasite pantothenate transporter. Scavenged radiolabeled lipoic acid was found to sequester solely in the mitochondrion and appeared to be attached to these proteins by the action of lipoic acid protein ligase LplA1.
The synthesis and scavenging pathways have generally been considered to operate separately, with no lipoic acid exchange occurring between the mitochondrion and apicoplast organelles

Phenotype
Normal blood stage development and development of mosquito stages. Normal production of salivary gland sporozoites (see also Additional information).
Reduced infectivity of sporozoites. Mice infected with sporozoites show a 4 day delay in prepatent period. Mutant liver stages have major defects during late liver stage development and do not produce detached cells during in vitro culture indicating an important role of LipB for formation of fully mature liver schizonts and viable merozoites..

Additional information
Apicoplast of  mutant blood stages had a similar morphology to that of wild type parasites as shown by immunofluorescence analysis using antibodies against the apicoplast-specific protein ACP (PBANKA_030560; acyl carier protein).

Evidence is presented for markedly reduced levels of lipoylated PDH-E2 and in the LipB-deficient parasites compared to the WT control. KGDH-E2 lipoylation levels appeared unaffected by the loss of LipB. This is consistent with the proposal that LipB lipoylates PDH-E2 within the apicoplast. We note that PbLipB contains an apicoplast-targeting motif as predicted by PlasmoAP and PDH-E2 is the only protein within the apicoplast that is known to require lipoylation. The other three proteins known to be lipoylated in Plasmodium are BCDH-E2, KGDH-E2, and the H-protein, which appear to localize to the mitochondria based on GFP-fusion studies in P. falciparum. These proteins were predicted to be lipoylated by the mitochondrial ligases LplA1 or LplA2.

By analysis of a mutant (RMgm-852) expressing a GFP-tagged version of BCDH-E2 evidence is presented that BCDH-E2 is NOT located in the apicoplast. These results suggest that LipB might be responsible for the lipoylation of the mitochondrial protein BCDH-E2, and evoke the possible movement of lipoic acid from the apicoplast to the mitochondria. An alternative explanation would be that LipB,  which has a N-terminal bipartite peptide that is predicted to traffic this protein to the apicoplast, could in part also traffic to the mitochondria.

Evidence is presented that the mutant has a reduced growth of asexual blood stages when mice has reduced serum lipid concentrations (induced by treatment of mice with clofibrate).

Apicoplast of mutant liver stages (after 24h) show an aberrant morphology (smaller and more constricted) compared to that of wild type parasites as shown by immunofluorescence analysis using antibodies against the apicoplast-specific protein ACP (PBANKA_030560; acyl carier protein).

Other mutants
A  mutant (RMgm-852) expressing a GFP-tagged version of BCDH-E2


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0707000
Gene Model P. falciparum ortholog PF3D7_0823600
Gene productlipoate-protein ligase B
Gene product: Alternative nameLipB
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid XbaI, ScaI, Acc65I
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TCATCTAGACGCGCATACACATATATTATATA
Additional information primer 1P2268 (XbaI); 5'UTR forward
Sequence Primer 2TGAGATATCGACATGCACACTTAAAATGAAC
Additional information primer 2P2269 (EcoRV); 5'UTR reverse
Sequence Primer 3ATGAAGCTTGACAGCTGATTAAATATAACAT
Additional information primer 3P2182 (HindIII); 3'UTR forward
Sequence Primer 4TGAGGTACCATATGCACTTTTGGCTGGAGG
Additional information primer 4P2350 (Acc65I); 3'UTR reverse
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt
61 aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc
121 gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgcctgat gcggtatttt
181 ctccttacgc atctgtgcgg tatttcacac cgcatatggt gcactctcag tacaatctgc
241 tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga
301 cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc
361 atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata
421 cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact
481 tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg
541 tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt
601 atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct
661 gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca
721 cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc
781 gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc
841 cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg
901 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta
961 tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc
1021 ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt
1081 gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg
1141 cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct
1201 tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc
1261 tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct
1321 cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac
1381 acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc
1441 tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat
1501 ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg
1561 accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc
1621 aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa
1681 ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag
1741 gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
1801 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta
1861 ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag
1921 ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg
1981 gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga aagcgccacg
2041 cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag
2101 cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc
2161 cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa
2221 aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg
2281 ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct
2341 gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa
2401 gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctgg
2461 cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttag
2521 ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat gttgtgtgga
2581 attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta cgccaagctt
2641 ccgcgggtat atggtaaaga acctactaac acaataaaat atttaaataa tgtatttcct
2701 ataaataaat ttacagattt attttttaat acaaaagata tagatatacc agaaataaat
2761 gatcagttta aaggttttaa attctttatg acatcattta taaatcatgg atcatatcca
2821 ctaacaatag aatgtggtgt aacaaatggt ggaactagtt ataaaagagc aattatttta
2881 ttgcatgttc gaactgattt aaaagataga ccagtttcat tttgtgattt tcgaaaagga
2941 gaattatata attatttgaa tgcttatact gaaggggatg tatgcataat aatttccaaa
3001 tcaaatacaa gttttggttt tagatgccca gtaaatacaa aaaaaatgcc aaaaaattgt
3061 tttacgcaag tatatgaaaa agggtatcta aatgacgcca ataaaattaa tactaaaaat
3121 gttattaact attcatttga aaatccagaa tatgcgctag ctggttytaa ttatacatta
3181 acaaaatcgt atcaatttga atgtcattgt gtagataaag aaacagaaca aattgtaaaa
3241 acggttttag tcaaatatgt aaatgaagat gaaatatatg attataatga ttttccaatg
3301 gtgaatcaca aacctattat tgcacatcca aataaaacac atcaagcttg catgcctgca
3361 gcccagctta attcttttcg agctctttat gcttaagttt acaatttaat attcatactt
3421 taagtatttt ttgtagtatc ctagatattg tgctttaaat gctcacccct caaagcacca
3481 gtaatatttt catccactga aataccatta aattttcaaa aaaatactat gcatataatg
3541 ttatacatat aaacataaaa cgccatgtaa atcaaaaaat atataaaaat atgtataaaa
3601 ataaatatgc actaaatata agctaattat gcataaaaat taaagtgccc tttattaact
3661 agtcgtaatt atttatattt ctatgttata aaaaaatcct catataataa tataattaat
3721 atatgtaatg ttttttttat tttataattt taatataaaa taatatgtaa attaattcaa
3781 aaaataaata taattgttgt gaaacaaaaa acgtaatttt ttcatttgcc ttcaaaattt
3841 aaatttattt taatatttcc taaaatatat atactttgtg tataaatata taaaaatata
3901 tatttgctta taaataaata aaaaatttta taaaacatag ggggatctat gagtaaagga
3961 gaagaacttt tcactggagt tgtcccaatt cttgttgaat tagatggtga tgttaatggg
4021 cacaaatttt ctgtcagtgg agagggtgaa ggtgatgcaa catacggaaa acttaccctt
4081 aaatttattt gcactactgg aaaactacct gttccatggc caacacttgt cactactttc
4141 ggttatggtg ttcaatgctt tgcgagatac ccagatcata tgaaacagca tgactttttc
4201 aagagtgcca tgcccgaagg ttatgtacag gaaagaacta tatttttcaa agatgacggg
4261 aactacaaga cacgtgctga agtcaagttt gaaggtgata cccttgttaa tagaatcgag
4321 ttaaaaggta ttgattttaa agaagatgga aacattcttg gacacaaatt ggaatacaac
4381 tataactcac acaatgtata catcatggca gacaaacaaa agaatggaat caaagttaac
4441 ttcaaaatta gacacaacat tgaagatgga agcgttcaac tagcagacca ttatcaacaa
4501 aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct gtccacacaa
4561 tctgcccttt cgaaagatcc caacgaaaag agagaccaca tggtccttct tgagtttgta
4621 acagctgctg ggattacaca tggcatggat gaactataca aagggatcct ggctagccag
4681 tcgacctgca ggcatgcaag cttgcggccg atccaaatgg aagacgccaa aaacataaag
4741 aaaggcccgg cgccattcta tccgctggaa gatggaaccg ctggagagca actgcataag
4801 gctatgaaga gatacgccct ggttcctgga acaattgctt ttacagatgc acatatcgag
4861 gtgaacatca cgtacgcgga atacttcgaa atgtccgttc ggttggcaga agctatgaaa
4921 cgatatgggc tgaatacaaa tcacagaatc gtcgtatgca gtgaaaactc tcttcaattc
4981 tttatgccgg tgttgggcgc gttatttatc ggagttgcag ttgcgcccgc gaacgacatt
5041 tataatgaac gtgaattgct caacagtatg aacatttcgc agcctaccgt agtgtttgtt
5101 tccaaaaagg ggttgcaaaa aattttgaac gtgcaaaaaa aattaccaat aatccagaaa
5161 attattatca tggattctaa aacggattac cagggatttc agtcgatgta cacgttcgtc
5221 acatctcatc tacctcccgg ttttaatgaa tacgattttg taccagagtc ctttgatcgt
5281 gacaaaacaa ttgcactgat aatgaattcc tctggatcta ctgggttacc taagggtgtg
5341 gcccttccgc atagaactgc ctgcgtcaga ttctcgcatg ccagagatcc tatttttggc
5401 aatcaaatca ttccggatac tgcgatttta agtgttgttc cattccatca cggttttgga
5461 atgtttacta cactcggata tttgatatgt ggatttcgag tcgtcttaat gtatagattt
5521 gaagaagagc tgtttttacg atcccttcag gattacaaaa ttcaaagtgc gttgctagta
5581 ccaaccctat tttcattctt cgccaaaagc actctgattg acaaatacga tttatctaat
5641 ttacacgaaa ttgcttctgg gggcgcacct ctttcgaaag aagtcgggga agcggttgca
5701 aaacgcttcc atcttccagg gatacgacaa ggatatgggc tcactgagac tacatcagct
5761 attctgatta cacccgaggg ggatgataaa ccgggcgcgg tcggtaaagt tgttccattt
5821 tttgaagcga aggttgtgga tctggatacc gggaaaacgc tgggcgttaa tcagagaggc
5881 gaattatgtg tcagaggacc tatgattatg tccggttatg taaacaatcc ggaagcgacc
5941 aacgccttga ttgacaagga tggatggcta cattctggag acatagctta ctgggacgaa
6001 gacgaacact tcttcatagt tgaccgcttg aagtctttaa ttaaatacaa aggatatcag
6061 gtggcccccg ctgaattgga atcgatattg ttacaacacc ccaacatctt cgacgcgggc
6121 gtggcaggtc ttcccgacga tgacgccggt gaacttcccg ccgccgttgt tgttttggag
6181 cacggaaaga cgatgacgga aaaagagatc gtggattacg tcgccagtca agtaacaacc
6241 gcgaaaaagt tgcgcggagg agttgtgttt gtggacgaag taccgaaagg tcttaccgga
6301 aaactcgacg caagaaaaat cagagagatc ctcataaagg ccaagaaggg cggaaagatc
6361 gccgtgtaat tctagaagat cccgtttttc ttacttatat atttatacca attgattgta
6421 tttataactg taaaaatgtg tatgttgtgt gcatattttt ttttgtgcat gcacatgcat
6481 gtaaatagct aaaattatga acattttatt ttttgttcag aaaaaaaaaa ctttacacac
6541 ataaaatggc tagtatgaat agccatattt tatataaatt aaatcctatg aatttatgac
6601 catattaaaa atttagatat ttatggaaca taatatgttt gaaacaataa gacaaaatta
6661 ttattattat tattattttt actgttataa ttatgttgtc tcttcaatga ttcataaata
6721 gttggacttg atttttaaaa tgtttataat atgattagca tagttaaata aaaaaagttg
6781 aaaaattaaa aaaaaacata taaacacaaa tgatgttttt tccttcaatt tcgggtaccg
6841 agctcgaatt ctcttgagcc cgttaatgaa atagatacaa ttcattcatg ttatatacat
6901 ctagaacata atctgaatat ggttcaagtt aaatgtccaa aaattataaa aagtgatgat
6961 atttttgatg gtaataccat aatagacacc aaggtaacat cacgaagtag tcaacaaaat
7021 aatttttatt tagaaaatac agatgttgaa ccagaagaaa tagagaaata taaaaatata
7081 gaatacatac cagaaaacga tgaagtaatg catctagaca aaaaagaaaa gctagatgat
7141 atattaccag gtgttatcat attagataaa aataaaatgt tcaaagaaaa aggacatttc
7201 acttttgtta ctccattaat tgtagaaaag gtattaatat taaaaatata ttgtgataat
7261 actaaaacaa taattaataa tatgaaaggg aaaaaaggta ttacagtaat aaggatttct
7321 caaaatacaa caaaaaataa attttatgga tgtgactttt caggtaattc taaaaaaaca
7381 ttttactatt ccaatgttta tgatttagaa aaaaaaaatg agttttgtga aatagaatta
7441 aaagaaaata tagtagttag cttaaattgt ccaactggta aaattaatcc aaaaaattgt
7501 tttagaaatg tatatataaa aagtaatatg aatgaacaaa caaccgaaaa tatagaaaat
7561 atatttaacg aaataaaagt tatagatgca gattatttta taaataattc atcaaccttt
7621 ttgatgattt ccaaaattac aaaaaaagag tttgattttt attgtacatg tgaagattat
7681 aaaaccaaaa atataggaac aatatatatt aaaaattatg aatatctaga ttcaaaacct
7741 aaatataaaa ataaacaaat ttcctatata gatgtagttc catacccgcg gggaaagggc
7801 g
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4