RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-788
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1329500; Gene model (P.falciparum): PF3D7_1466100; Gene product: protein phosphatase containing kelch-like domains (PPKL; PPalpha; PfPPα)
Name tag: GFP
Phenotype Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 11 November 2012, 15:49
  *RMgm-788
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23028336
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943)
The mutant parasite was generated by
Name PI/ResearcherD.S. Guttery; R. Tewari
Name Group/DepartmentCentre for Genetics and Genomics, School of Biology, Queens Medical Centre
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-788
Principal namePPKL-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteThe intensity of PPKL-GFP fluorescence in sexual stages was highest in the nuclear and cytoplasmic compartments of female gametocytes and zygotes, and in the apical cytoplasm of ookinetes. The protein was also detected in oocysts and sporozoites, but was not observed in activated microgametocytes or microgametes
Fertilization and ookineteThe intensity of PPKL-GFP fluorescence in sexual stages was highest in the nuclear and cytoplasmic compartments of female gametocytes and zygotes, and in the apical cytoplasm of ookinetes. The protein was also detected in oocysts and sporozoites, but was not observed in activated microgametocytes or microgametes
OocystThe intensity of PPKL-GFP fluorescence in sexual stages was highest in the nuclear and cytoplasmic compartments of female gametocytes and zygotes, and in the apical cytoplasm of ookinetes. The protein was also detected in oocysts and sporozoites, but was not observed in activated microgametocytes or microgametes
SporozoiteThe intensity of PPKL-GFP fluorescence in sexual stages was highest in the nuclear and cytoplasmic compartments of female gametocytes and zygotes, and in the apical cytoplasm of ookinetes. The protein was also detected in oocysts and sporozoites, but was not observed in activated microgametocytes or microgametes
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal GFP-tagged version of PPKL (protein phosphatase containing kelch-like domains).

Protein (function)
PPKL is a distinctive PP1-related enzyme belonging to the PPP family of phosphatases comprising an N-terminal kelch repeat domain and a C-terminal PP1-like phosphatase domain (named PPKL: Protein Phosphatase with Kelch-Like domains). It has been detected in the apicomplexans Cryptosporidium hominis, Toxoplasma gondii and Theileria parva (one gene per genome), as well as in the land plants Arabidopsis thaliana and Oryza sativa (4 and 5 genes respectively). The kelch motif is widespread and involved in many cellular functions, particularly in actin-based cytoskeleton formation and transcriptional regulation. PPKL has only been studied in detail in Arabidopsis thaliana (where it is known as BSU1 or bri1 suppressor1) and along with the kinase BIN2, is involved in brassinosteroid hormone signalling and phosphorylation of the transcription factors BZR1 and BES1

In contrast to the human phosphatome (comprising approximately 156 phosphatases the Plasmodium genome codes for one of the smallest phosphatomes of all the eukaryotic phyla known to date, with 27 putative protein phosphatases falling into four major classes: phosphoprotein phosphatases (PPPs), metallo-dependent protein phosphatases (PPMs), protein tyrosine phosphatases (PTPs) and NLI interacting factor-like phosphatases (NIFs).

Phenotype analyses of mutants lacking expression of PPKL (RMgm-686, RMgm-687) indicate an essential role of PPKL in maturation of ookinetes.
Deletion of the ppkl gene caused abnormal ookinete development and differentiation, and dissociated apical microtubules from the innermembrane complex, generating an immotile phenotype and failure to invade the mosquito midgut epithelium.

Phenotype
Phenotype analyses of mutants lacking expression of PPKL (RMgm-686, RMgm-687) indicate an essential role of PPKL in maturation of ookinetes.

PPKL has protein phosphatase enzyme activity, and is highly expressed in female gametocytes and ookinetes. ppkl mRNA is also expressed in asexual blood stages, with the highest expression in schizonts relative to hsp70 and arginyl-tRNA synthetase genes used as controls. Analysis of a mutant expressing GFP-tagged PPKL shows that the intensity of PPKL-GFP fluorescence in sexual stages was highest in the nuclear and cytoplasmic compartments of female gametocytes and zygotes, and in the apical cytoplasm of ookinetes. The protein was also detected in oocysts and sporozoites, but was not observed in activated microgametocytes or microgametes

Additional information

Other mutants
RMgm-785: An independent mutant lacking expression of PPKL
RMgm-786: A mutant expressing an endogenous GFP-tagged version of PPKL
RMgm-787: An independent mutant lacking expression of PPKL
 


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1329500
Gene Model P. falciparum ortholog PF3D7_1466100
Gene productprotein phosphatase containing kelch-like domains
Gene product: Alternative namePPKL; PPalpha; PfPPα
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodiesanti-GFP polyclonal antibody (Invitrogen)
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid BglII
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor GFP-tagging by single homologous recombination, a 1047 bp region of ppkl starting 1693 bp downstream of the ATG start codon and omitting the stop codon was amplified using primers P1tag F (5'-CCCCGGTACCGAGCTCCGATAAAAATATATGGTGATATAC-3') and P1tag R (5'-CCCCGGGCCCTGGAGCCCCATAATTTAATTCTCTC-3'), producing an amplicon 1047 bp in length. This was inserted upstream of the gfp sequence in the p277 vector using KpnI and ApaI restriction sites. The p277 vector contains the human dhfr cassette, also conveying resistance to pyrimethamine. Before transfection, the sequence was linearized using BglII.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGTACCGAGCTCCGATAAAAATATATGGTGA
Additional information primer 1P1tag F
Sequence Primer 2CCCCGGGCCCTGGAGCCCCATAATTTAATTCTCTC
Additional information primer 2P1tag R
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6