RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-744
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0510600; Gene model (P.falciparum): PF3D7_1026400; Gene product: cell division cycle protein 20 homolog, putative (CDC20; CDH1)
Name tag: GFP
Phenotype Asexual bloodstage; Gametocyte/Gamete;
Last modified: 27 May 2012, 15:36
  *RMgm-744
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22383885
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherD.S. Guttery; R. Tewari
Name Group/DepartmentCentre for Genetics and Genomics, School of Biology Queens Medical Centre
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-744
Principal nameCDC20-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageAnalyses of mutants expressing C-terminally GFP-tagged CDC20 provided evidence for expression of CDC20 in nuclei of all blood stages (asexual and sexual) with upregulation in nuclei of male gametocytes.
Gametocyte/GameteAnalyses of mutants expressing C-terminally GFP-tagged CDC20 provided evidence for expression of CDC20 in nuclei of all blood stages (asexual and sexual) with upregulation in nuclei of male gametocytes.
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal GFP-tagged version of cell division cycle protein 20 homolog, putative (CDC20/CDH1). The endogenous cdc20 gene is tagged with GFP.

Protein (function)
During eukaryotic mitosis anaphase and mitotic exit is regulated by the conserved multi-subunit E3 ubiquitin ligase Anaphase Promoting Complex/Cyclosome (APC/C), which targets mitotic regulators such as securin and cyclin B for destruction by the 26S proteosome. Two of the major regulators of APC/C activity are cell-division cycle protein 20 (CDC20) (also known as Fizzy, p55CDC or Slp1) and its homologue, CDC20 homologue 1 (CDH1 – also known as Cdh1p/Hct1p, Fizzy-related, Ste9, Srw1 or Ccs52). CDC20 and CDH1 are related tryptophan-aspartic acid (WD)-40 repeat- containing adaptor proteins, which are highly conserved throughout eukaryotic evolution. CDC20 protein accumulates during S-phase, peaks in mitosis and activates the phosphorylated APC/C complex (which is phosphorylated by cyclin-dependent kinase 1 (CDK1) and other mitotic kinases by physical association, which results in the activation of the metaphase-anaphase transition and degradation of mitotic cyclins via ubiquitination.
Sequence analyses of P. berghei identified a cdc20 gene (PBANKA_051060) comprised of one exon. The protein contains a classical KEN-box, RVL-cyclin binding motif, IR motif and seven WD-40 repeat motifs as found in CDC20 and CDH1 of other organisms, but does not contain a C-box, D-box or a Mad2-interacting motif. Only a single CDC20/CDH1 homologue was identified in diferent Plasmodium species.

P. berghei mutants lacking CDC20/CDH1 (RMgm-746) showed a normal multiplication of the asexual blood stages and normal production of gametocytes. However, male gametocytes fail to form gametes (exflagellate), whereas female gametocytes produce fertile female gametes (as shown by cross-fertilisation with wild-type male gametes). Evidence is presented that genome replication in the activated male gametocytes (for formation of the 8 haploid male gametes) and formation of axonemes is not affected.

Phenotype
P. berghei mutants lacking CDC20/CDH1 (RMgm-746) showed a normal multiplication of the asexual blood stages and normal production of gametocytes. However, male gametocytes fail to form gametes (exflagellate), whereas female gametocytes produce fertile female gametes (as shown by cross-fertilisation with wild-type male gametes). Evidence is presented that genome replication in the activated male gametocytes (for formation of the 8 haploid male gametes) and formation of axonemes is not affected.

Analyses of mutants expressing C-terminally GFP-tagged CDC20 provided evidence for expression of CDC20 in nuclei of all blood stages (asexual and sexual) with upregulation in nuclei of male gametocytes.

Additional information

Other mutants
RMgm-745: a mutant expressing GFP-tagged CDC20 episomally (using the same plasmid utilized to target the endogenous locus described in RMgm-744) under control of the cdc20 promoter
RMgm-746: A mutant lacking expression of CDC20


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0510600
Gene Model P. falciparum ortholog PF3D7_1026400
Gene productcell division cycle protein 20 homolog, putative
Gene product: Alternative nameCDC20; CDH1
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid HindIII
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor GFP-tagging by single homologous recombination, a 2435 bp region of Pbcdc20 starting 812 bp upstream of the start codon and omitting the stop codon was amplified using primers T36-1 (5’-CCCCGGTACCCTTATTTATGAAAACGATTATAAGG-3’) and T36-2 (5’-CCCCGGGCCCCCTGATTATTTCATAATAATTTTCAAAGGG-3’), producing an amplicon 2435 bp in length. This was then inserted upstream of the gfp sequence in the p277 vector using KpnI and ApaI restriction sites. The p277 vector contains the human dhfr cassette, conveying resistance to pyrimethamine. Before transfection, the sequence was linearized using HindIII
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGTACCCTTATTTATGAAAACGATTATAAGG
Additional information primer 1T36-1
Sequence Primer 2CCCCGGGCCCCCTGATTATTTCATAATAATTTTCAAAGGG
Additional information primer 2T36-2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6