SummaryRMgm-702
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : v |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei K173 |
Name parent line/clone | P. berghei K173 cl1 |
Other information parent line | The K173cl1 is a cloned laboratory line of the K173 strain of P. berghei that lacks gametocyte production and sequestration of schizonts. The absence gametocyte production and schizont-sequestration can most likely be explained by the laboratory history of this line; it has been kept for more than 20 years in mice by mechanical blood passage; its chromosomes are reduced in size as a result of the loss of subtelomeric genes and repeat elements (PubMed: PMID: 2674047; 2649389). This line has frequently been used to study P. berghei ECM (PubMed: PMID: 2230643; 9806067). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | E.M. Pasini, C.J. Janse, B.M.D. Franke-Fayard |
Name Group/Department | Department of Parasitology |
Name Institute | Biomedical Primate Research Centre |
City | Rijswijk |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-702 |
Principal name | 2065; 2066 |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | No |
top of page | |
Phenotype | |
Asexual blood stage | The tagged-protein is exported into the cytoplasm of the host erythrocyte and shows a location at the surface membrane of infected erythrocytes |
Gametocyte/Gamete | Not tested |
Fertilization and ookinete | Not tested |
Oocyst | Not tested |
Sporozoite | Not tested |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0316800 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||||||||||
Gene product | erythrocyte membrane associated protein 2 | ||||||||||||||||||||||||||
Gene product: Alternative name | EMAP2: erythrocyte memberane associated protein 2 | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | mCherry | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | |||||||||||||||||||||||||||
Commercial source of tag-antibodies | Clontech | ||||||||||||||||||||||||||
Type of plasmid/construct | Plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence |
CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTC
| ||||||||||||||||||||||||||
Restriction sites to linearize plasmid | ClaI | ||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |