RMgmDB - Rodent Malaria genetically modified Parasites
SummaryRMgm-662
|
||||||||||
Last modified: 4 October 2017, 12:36
*RMgm-662| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption, Introduction of a transgene |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 22184632 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 1037m1f1mocl1 (RMgm-32) |
| Other information parent line | P. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | J. Fonager; B. Franke-Fayard; C.J. Janse |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-662 |
| Principal name | 1242cl5m2cl1 |
| Alternative name | Δsmac3(-sm) |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Asexual blood stages show a reduced growth rate in mice (see 'Additional remarks phenotype') |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation Protein (function) Additional information Analyses of a mutant expressing a mCherry-tagged version of SMAC (SMAC::mCherry; RMgm-663) showed export of SMAC into the cytoplasm of the host erythrocyte. Staining of live SMAC::mCherry and wild type infected erythrocytes with anti-mCherry or anti-SMAC antibodies did not provide evidence for exposure of SMAC on the surface of infected erythrocytes. Other mutants |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0100600 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||||||||
| Gene product | schizont membrane associated cytoadherence protein | ||||||||||||||||||||||||
| Gene product: Alternative name | Schizont Membrane Associated Cytoadherence protein; SMAC. | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
  
| ||||||||||||||||||||||||
| Plasmid/construct sequence |
ATCGAATTCCTAAGATCATTATGGGATCATCTGCAGCGATATTTTTTCTTGTCGAAGATT
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | Asp718, XbaI, ScaI | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | 5-fluorocytosine (5-FC) | ||||||||||||||||||||||||
| Additional remarks genetic modification | Two general gene targeting DNA constructs pL0001 or pL0037 were used to generate constructs to disrupt the genes selected from the proteome analyses. These constructs are aimed at targeted gene disruption by double cross-over homologous recombination. Sequences of the open reading frame (ORF) and UTR regions of the selected genes were retrieved from PlasmoDB and GeneDB (www.plasmodb.org; www.genedb.org). To replace the ORF of the target genes with the selection cassette containing the pyrimethamine-resistant dhfr/ts of Toxoplasma gondii, the 5′ and 3′ flanking regions of the ORF were cloned up- and down-stream of the selection cassette of pL0001 or pL0037. To obtain a drug-selectable marker free Δsmac parasites line, the positive T. gondii dhfr/ts selectable marker of pL1351 was replaced with the drug selection cassette of pL0037 (HindIII/EcoRI fragment) that contains a fusion of the positive selectable marker, hdhfr, and the negative selectable marker yfcu (Braks et al., 2006). This construct, pL1386, was used to transfect parasites of reference line wt-GFP-Lucschiz and positive selection with pyrimethamine followed by cloning of parasites resulted in the generation of line 1242cl5 (Δsmac3). To select for parasites which had removed the selectable marker cassette we applied negative selection with 5-fluorocytosine (5-FC) | ||||||||||||||||||||||||
| Additional remarks selection procedure | The mutant does not contain a drug selectable marker which has been removed by the negative selection procedure using the negative selectable marker yfcu (yeast cytosine deaminase and uridyl-phosphoribosyltransferase) and the drug 5-fluorocytosine (5-FC)( (Braks et al., 2006, Nucleic Acids Res 34, e39). | ||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
Transgene: Mutant parasite expressing a transgene| top of page | |||||||||||||||||||
| Type and details of transgene | |||||||||||||||||||
| Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
| Transgene name | A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV) | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
| Plasmid/construct map |
| ||||||||||||||||||
| Plasmid/construct sequence |
1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc
| ||||||||||||||||||
| Restriction sites to linearize plasmid | KspI (SacII) | ||||||||||||||||||
| Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
| Promoter of the selectable marker | ama-1 | ||||||||||||||||||
| Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||
| Additional remarks genetic modification | The GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration. | ||||||||||||||||||
| Additional remarks selection procedure | This reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence. | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Other details transgene | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Promoter | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0915000 | ||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1133400 | ||||||||||||||||||
| Gene product | apical membrane antigen 1 | ||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
| 3'-UTR | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
| Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
| Insertion/Replacement locus | |||||||||||||||||||
| Replacement / Insertion | Replacement locus | ||||||||||||||||||
| Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
| Gene product | 6-cysteine protein | ||||||||||||||||||
| Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||